53

Как новые петли в ДНК помогают создавать разнообразные антитела? (Научная Россия, 13 сентября)

Издание Научная Россия приводит сообщение Eurekalert.org об исследовании Бостонской детской больницы, объясняющем процесс достижения иммунной системой разнообразия антител (Eurekalert.org ссылается на Nature).


Разнообразие - это хорошо, особенно когда речь идет о антителах. Давно известно, что процесс сборки генов, называемый рекомбинацией V(D)J, позволяет нашей иммунной системе смешивать и сопоставлять фрагменты генетического кода, генерируя новые антитела для преодоления возникающих угроз. Но как эти генные сегменты собираются вместе для соединения, остается загадкой. Новое исследование дает ответ.


Наши нити ДНК вместе с определенными белками организованы в упаковку под названием хроматин, которая содержит несколько петель. Когда клетке необходимо построить определенный белок, петли хроматина приводят два относительно удаленных сегмента ДНК в непосредственную близость, чтобы они могли работать вместе. Многие из этих петель зафиксированы на месте, но клетки могут иногда переставлять петли или создавать новые петли, когда это необходимо, особенно раковые клетки и иммунные клетки.


Новое исследование под руководством Фредерика Альта - директора Программы клеточной и молекулярной медицины в Бостонской детской больнице - показывает в мельчайших деталях, как В-клетки нашей иммунной системы используют процесс образования петель для создания новых видов антител.


Исследователи показывают, что пара ферментов, называемых RAG1 и RAG2, соединяется с механизмами, участвующими в создании петель хроматина, чтобы инициировать первый этап рекомбинации V(D)J - соединение сегментов D и J. Комплекс RAG 1/2 сначала связывается с участком гена антитела, известным как «центр рекомбинации». Когда ДНК прокручивается в процессе формирования петли («экструзия»), комплекс RAG сканирует сегменты D и J, которые клетка хочет объединить. Другие факторы затем препятствуют процессу экструзии, останавливая прокрутку ДНК в центре рекомбинации, чтобы RAG мог получить доступ к нужным сегментам.


«Процесс экструзии петли используется локусами гена антитела, чтобы правильно представить сегменты гена субстрата в комплексе RAG для рекомбинации V(D)J», - говорит Альт.


Хотя многие из проводных петель хроматина образуются и закрепляются фактором, известным как CTCF, лаборатория Alt показывает, что другие факторы участвуют в динамических ситуациях, таких как образование антител, которые требуют новых петель на лету. Исследование также устанавливает роль белка под названием кохезин в управлении процессом экструзии петли/RAG-сканирования.


«Хотя эти результаты были сделаны в контексте рекомбинации V(D)J при образовании антител, они имеют значение для процессов, которые могут быть вовлечены в регуляцию генов в более общем плане», - говорит Альт.

Как новые петли в ДНК помогают создавать разнообразные антитела? (Научная Россия, 13 сентября) Наука, Новости, Генетика, ДНК

Найдены возможные дубликаты

+1

Сколько миллионов лет эволюции понадобилось, чтобы создать такой механизм?!!

0
Нихуя не понятно, но очень интересно.
Иллюстрация к комментарию
0
Ох, бля, доиграются
Похожие посты
90

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные

Через Уральский регион проходили многочисленные миграционные маршруты, которые, помимо прочего, повлияли и на историю Европы. Археологические свидетельства этих событий можно наблюдать на раннесредневековых кладбищах Южного Урала. Для этой территории типичны компактные кладбища с несколькими сотнями гробниц, которые впервые за последние 10–15 лет стали источником богатых археологических находок. Согласно археологическим, лингвистическим и историческим данным, корни современных венгров можно проследить до Уральского региона. Судя по лингвистическим свидетельствам венгерский язык, принадлежащий к финно-угорской ветви уральской языковой семьи, возник к востоку от Урала, где-то между 1000 и 500 годами до н. э. Вероятно, после VI века н. э. часть предков венгров переселилась со своей древней родины в Предуралье, т.е. на территории, прилегающие к западному склону Урала. А примерно, в первой трети IX века н. э., часть этого населения Предуралья, под давлением Хазарского каганата пересекла Волгу и заняла Северное Причерноморье, вступив в союз с хазарами.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

При этом, конец IX века характеризуется началом упадка хазарского мира, в котором особую, но не единственную, роль сыграли печенеги. Также немаловажным было и формирование Древнерусского государства с выходом из-под контроля хазар части восточнославянских племён. Ранние венгры жили в Восточной Европе (формируя так называемый "субботцевский горизонт" ещё до того, как они вторглись в Паннонию, уже в более разнообразном составе. В X веке, материальные черты Карпатского бассейна быстро менялись после завоевания, с многочисленными археологическими свидетельствами связей с восточноевропейскими регионами, которые прослеживаются до Урала. Однако генетических данных от доисторического периода до средневековых популяций Уральского региона не так много в отличии от средневековых популяций Карпатского бассейна. В более ранних работах авторы предположили, что смешанные популяции степных кочевников (среднеазиатских скифов - саков) и потомков восточноевропейской срубной культуры, помимо других неописанных популяций, могло быть основой генетического состава венгерских завоевателей. Кроме того, предыдущие результаты предполагают генетические связи венгерских завоевателей с гуннами, а также с их предшественниками хунну. В последних статьях, которые касались изменчивости отцовских линий элиты венгров, они описывались как генетически неоднородные, со значительной долей европейского, финно-угорского, кавказского и сибирского или восточноевразийского вклада по отцовской линии.

Из чего следует, что мужские предковые линии венгерских завоевателей были из трёх отдалённых источников, а именно из Внутренней Азии (Байкал — Алтайские горы), Западной Сибири — Южного Урала (финно-угорские народы) и Причерноморья — Северного Кавказа (северокавказские тюрки, Аланы и восточноевропейские популяции того времени).

Оба вышеупомянутых исследования указали на присутствие Y-гаплогруппы N1a1a1a1a2-Z1936, ранее известной как N3a4-Z1936 в составе N-Tat / M46), которая часто встречается среди народов, говорящих на финно-угорских языках.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Эта линия также встречается среди современных венгров с частотой до 4%. В последующих работах исследователи реконструировали детальную филогению Y-гаплогруппы N-Z1936, показав, что определённые её субклады являются общими для некоторых этнических групп, как к примеру, N-Y24365 / B545 встречается у татар, башкир и венгров и связывает современных венгров с людьми, живущими в Волго-Уральском регионе.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Более ранние исследования митохондриальной ДНК современных популяций, говорящих на уральских языках, предполагают, что распространение линий мтДНК Восточной и Западной Евразии определяется географическими расстояниями, а не языковыми барьерами. Например, финно-угорские популяции из Волго-Уральского региона, по мтДНК, кажутся более похожими на своих тюркоязычных соседей, чем на родственные по языку прибалтийско-финские этнические группы. Более свежее исследование (от 2018 года) 15 уралоязычных популяций, также описывает их сходство с соседними популяциями, но помимо этого указывает ещё и на дополнительный компонент, возможно, сибирского происхождения.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Однако несмотря на то, что некоторые митохондриальные линии современных венгров имеют возможное сибирское происхождение, их генофонд отличается от других уралоязычных народов.


ЦЕЛЬ ИССЛЕДОВАНИЯ


При сборе 36 образцов древней ДНК из Уральского региона, наиболее важным намерением было подобрать профессионально раскопанные и задокументированные захоронения Южного Урала, которые культурно или по времени связаны с предками венгров. При этом наибольшее сходство с археологическими памятниками Карпатской котловины X века продемонстрировал археологический памятник Уелги Южного Зауралья, Кунашакского района Челябинской области. Это кладбище использовалось с позднего периода кушнаренковской культуры в VIII веке и по XI век.

Учитывая различные взгляды на события того времени в регионе, авторы работы стремились охватить широкий спектр раннесредневековых археологических культур, расположенных в среднем течении Камы к западу от Урала.

Учёные связывают прекращение существования неволинской культуры в VIII – IX веках н. э. с миграцией на запад предков венгров, поэтому отбор образцов проводился во всех трёх группах этой культуры: бродовской (III – IV вв.), бартымской (V – VI вв.) и сухоложской (VII – VIII вв. н. э.). Помимо этого, был исследован Бояновский могильник (IX – X вв. н.э.) в Добрянском районе Пермского края. Этот археологический участок представляет собой южный вариант ломоватовской культуры, которая в свою очередь, демонстрирует тесную культурную связь с неволинской культурой из более южных регионов. Также, помимо новых образцов, было повторно проанализировано девять образцов древних венгров из Карпатского бассейна X – XII веков на предмет обнаружения целых митогеномов. Эти образцы были отобраны из предыдущего исследования на основе идентичных гаплотипов мтДНК с некоторыми из исследованных представителей Урала.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

А основная цель новой научной работы заключалась в том, чтобы охарактеризовать материнский и отцовский генетический состав популяций Южного Урала с III по XI в и сравнить результаты с доступными древними и современными наборами генетических данных Евразии. Авторы работы также стремились описать возможные генетические связи между изученными уральскими популяциями и популяциями периода завоевания Карпатского бассейна.


ВЫВОДЫ


Уральский регион играл важную роль в этногенезе древних венгров, основываясь на археологических, лингвистических и исторических источниках, хотя результаты этих исследований демонстрируют различия в хронологическом и культурном аспектах. Представленные новые данные о мтДНК, Y-хромосоме и аутосомной последовательности ДНК образцов Южного Урала также подтверждают актуальность региона с точки зрения популяционной генетики. Общий материнский состав исследованных образцов из Уральского региона с филогенетической и филогеографической точек зрения предполагает смешанное западное и восточное происхождение компонентов, хотя отцовские линии более однородны, с Y-гаплогруппами характерными для Волго-Уральского региона. Гаплогруппа Y-хромосомы N-M46 с субкладами составляет 83,3% остальные представлены гаплогруппами G2a (G-L1266), J2 и R1b.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Также стоит отметить, что точно отнести каждый митохондриальный гаплотип Уелги к западному или восточному не представляется возможным, но представители обоих направлений присутствуют. Митохондриальные гаплогруппы европейского происхождения N1a1a1a1a и H40b предполагают, что существовала базовая популяция с характеристиками ближе к западным. С другой стороны, схожие (С4а1а6) или единичные (A, A12a, C4a2a1) восточные гаплотипы, отчётливо заметные в третьем (сухоложском) горизонте, предполагают относительно недавнюю примесь к основной популяции.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Однако очевидному сосуществованию генетического и археологического сдвига, противоречат однородность предковых компонентов и отцовского состава, а также анализ главных компонент и наличие восточного вклада С4а1а6 во всех горизонтах.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Хотя сам факт однородности по отцовским линиям можно объяснить патрилокальностью. Несмотря на то, что генетический вклад популяции, относящейся к сросткинской культуре Северного Алтая и южных районов Западной Сибири исключать нельзя, более вероятно, что большинство восточных компонентов смешалось ещё до начала использования уелгинского могильника. Материнские и отцовские линии древнего населения Уелги сигнализирует о том, что они хронологически и/или географически связаны с возможным генетическим источником венгерских завоевателей. Т.е. не с самими древними венграми, а с их предками. Помимо этого, захороненные на кладбище Уелги, по предварительным аутосомным данным, разделяют свой частотный состав аллелей с современными уральскими и западносибирскими популяциями, которые лингвистически или исторически связаны с венграми, что обеспечивает хорошую почву для будущих исследований.

Что касается материнских линий, то связи древних жителей Уелги с венгерскими завоевателями можно разделить на прямые и косвенные. Косвенные могут исходить от базовой популяции Южного Урала с более европейским генетическим профилем, в то время как прямые связи характерны преимущественно для смешанного восточного компонента. Одним из возможных объяснений этого феномена является то, что древние венгры и жители Уелги в прошлом имели общих предков и у этих предков уже была восточная примесь, которая впоследствии попала к обеим группам. Точное происхождение восточного компонента ещё предстоит описать, однако некоторые косвенные связи указывают на Центральную Азию. На графике анализа главных компонент, древние жители Уелги расположились в районе представителей окуневской культуры бронзового века, а также между уралоязычными группами и тюркоязычными популяциями Центральной степи.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка
Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Также филогенетический состав популяций Предуралья ставит под сомнение их генетическую однородность и последовательность. Но чтобы это проверить, нужно больше данных.

В новой работе родственные связи с древними венграми носят единичный характер, однако при этом наблюдается региональная близость, которая более выражена на графиках анализа главных компонент и многомерного шкалирования.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Т.е. люди из этих популяций не являются прямыми родственниками, однако близки к ним. В целом исследование демонстрирует генетическую связь между Зауральем, Предуральем и Карпатским бассейном на разных уровнях. Анализ этого нового набора данных заполняет пробелы в популяционной генетике Евразии, а также дополняет и корректирует выводы, сделанные ранее.

В более ранних работах, основанных на генетическом составе венгерских завоевателей и хунну, о которых также упоминалось в роликах канала, сообщалось о связи древних венгров с различными восточными регионами. Однако в этих исследованиях не участвовали регионы Урала, где присутствие редких восточноевразийских гаплотипов в популяциях позднего железного века и раннего средневековья к западу от Урала (Предуралье), может изменить представление о контактах востока и запада в будущем.

В последующих исследованиях авторы планируют расширить набор генетических данных с высоким охватом и включить образцы из других восточноевропейских кладбищ древних венгров и соседних с ними общин.

Источник:

Csáky, V., Gerber, D., Szeifert, B. et al. Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians. Sci Rep 10, 19137 (2020). doi.org/10.1038/s41598-020-75910-z
Показать полностью 10
80

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК

Приручение лошади около 5,5 тыс. лет назад представляет собой одно из важнейших технологических достижений древнего мира, поскольку лошади произвели революцию в транспорте и повлияли на модели торговли, войны и миграций. Археологические и органические остатки, а также генетический анализ позволяют предположить, что домашняя лошадь возникла в степях Центральной Азии, после чего распространилась по Восточной Европе, а затем и по Передней Азии. Данные из контекста ботайской культуры Казахстана предполагают, что к середине - концу четвёртого тысячелетия до н. э. лошадей могли содержать и доить. Но эти доводы оспариваются, потому как ряд учёных сочли доказательства одомашнивания лошадей ботайцами не убедительными, хотя и отметили хорошую работу исследователей, но подвергли сомнению интерпретацию результатов. Исследование геномов древних лошадей поставило под сомнение точку зрения о том, что современные домашние лошади произошли из Центральной Азии, поскольку было показано, что так называемые «ботайские» лошади являются предками лошадей Пржевальского в Северо-Восточной Азии, но не являются основным источником древних или современных домашних лошадей. Другое недавнее исследование исключило Пиренейский полуостров, как второй потенциальный центр одомашнивания лошадей, показав, что иберийские дикие лошади вымерли, не оставив заметных следов в геномах современных.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Однако оставалось ещё две области, которые были предложены в качестве центров приручения современных лошадей: это Причерноморско-Каспийская степь и Анатолия. Хотя степь уже долгое время считается наиболее вероятным источником домашних лошадей, Анатолия с этой точки зрения плохо изучена, несмотря на её долгую историю использования диких лошадей, а также репутацию как производителя ценных пород лошадей в античном мире. Комбинация текстов, изображений и археозоологических данных позволяет предположить, что к середине-концу III тысячелетия до н. э. домашние лошади были завезены из соседних горных регионов в Месопотамию (современный Ирак и северо-восток Сирии), где они часто упоминались в клинописных текстах как «горные ослы».

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Царь Ассирии Ашшурнацирапал II охотится на львов

Изначально содержавшиеся в небольшом количестве, лошади стали широко известны в Передней Азии в течение нескольких столетий в связи с распространением колесниц, технологического новшества второго тысячелетия до н. э.

Поскольку одомашнивание лошадей в евразийских степях, регионе, исторически известном своими так называемыми “конными культурами”, вероятно, началось в четвёртом или, возможно, даже пятом тысячелетии до н. э., долгое время утверждалось, что лошади Передней Азии являются потомками этих ранних одомашненных степных лошадей, которые прибыли в регион по средствам ещё недостаточно изученных процессов миграций или обмена с участием жителей Причерноморско-Каспийской степи и Кавказских регионов. Всего у лошадей, на данный момент выявлено 18 основных гаплогрупп (от A до R), время разделения которых относится в основном к неолиту и более поздним периодам.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Домашние лошади демонстрируют гораздо более высокую степень генетической изменчивости митохондриальных линий по сравнению с крупным рогатым скотом, а также свиньями и овцами. При этом, большинство митохондриальных линий, наблюдаемых у домашних лошадей, существовало ещё до приручения. Однако эти анализы древних лошадей не дали чёткой филогеографической структуры, которая позволила бы установить пространственно-временное происхождение и центр их одомашнивания. Ведь результаты предполагают, что лошади на севере Евразии постоянно мигрировали и смешивались. А вот что касается мужской линии, то у современных лошадей выявлен только один гаплотип, что привело к поспешным выводам о едином событии одомашнивания. Но анализ древних образцов указал на дополнительные мужские линии в доисторических популяциях до одомашнивания и показал, что генетически разнородные самцы-основатели участвовали в раннем одомашнивании.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Впоследствии это разнообразие сократилось, вероятно, в результате более направленного отбора человеком, который, скорее всего, начался в железном веке и продолжался во времена Римской империи и после VII-IX вв. н. э.

Палеогенетические данные по генетическим локусам, связанным с окрасом шерсти у лошадей, свидетельствуют об увеличении разнообразия окраса шерсти начиная с бронзового века, что считается ранней стадией процесса одомашнивания и является обычным явлением для домашних таксонов по сравнению с их дикими аналогами. Поэтому появление новых окрасов шерсти служит полезным маркером для идентификации домашних лошадей в археологических комплексах.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

До сих пор происхождение домашних лошадей в Анатолии оставалось малоизученным, однако тщательное извлечение останков лошадей из хорошо датированных археологических контекстов в Анатолии и на соседнем Кавказе, совместно с прогрессом в палеогенетических методах, теперь позволяет конкретно рассмотреть процессы, ответственные за происхождение домашних лошадей в этой части Передней Азии.

В своей работе международная группа исследователей объединила морфологическую классификацию останков непарнокопытных с палеогенетическим анализом митохондриальной ДНК, Y-хромосомы и аутосомных ДНК-маркеров, связанных с окрасом шерсти, для отслеживания пространственно-временной динамики появления домашних лошадей в Анатолии.

Чтобы прояснить давний вопрос в истории Ближнего Востока о местном приручении лошадей в Анатолии было проанализировано более 100 останков лошадей из 14 доисторических поселений Центральной Анатолии и Кавказа, охватывающих большую часть голоцена, а именно с 9-го тысячелетия до н. э. по 1-е тысячелетие н. э.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Результаты


Дикие и домашние лошади в Анатолии


Результаты позволяют сделать вывод о том, что домашние лошади были завезены на Кавказ и в Анатолию по крайней мере в 2000 г. до н. э., предположительно из Евразийской степи.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Этот вывод основан на том факте, что в Анатолии местные популяции лошадей до 6,5 тыс. лет назад несут только две митохондриальные гаплогруппы, P и X, причём последняя является ранее незарегистрированным гаплотипом, принадлежащим поддереву O-P-Q. До сих пор эти гаплогруппы не встречались где-либо ещё в Евразии в современном или более раннем контексте. Более того, гаплотип X, вероятно, имел ограниченное временное распространение в Анатолии голоцена, возможно, исчезнув после 5500 г. до н.э.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Данные подтверждают вывод о том, что эти две гаплогруппы отражают локальные митохондриальные признаки диких лошадей, на которых охотились в Анатолии в раннем и среднем голоцене. Исследователи предполагают, что гаплогруппы P и X развивались независимо в Анатолии в течение позднего плейстоцена и раннего голоцена со слабым или полностью отсутствующим потоком генов от соседних популяций диких лошадей из-за географических барьеров, отделяющих Анатолию от северной Евразии, а именно Босфора, а также гор Загрос и Кавказа. Таким образом, новое исследование предоставляет первые доказательства того, что Анатолия была домом для генетически отличающейся популяции диких лошадей, которые, согласно археозоологическим находкам, широко использовались в периоды неолита и энеолита. Остатки лошадей раннего неолита Ашиклы-Хююк, неолита / энеолита Кёшка-Хююк и позднего энеолита / раннего бронзового века Чадир-Хююк, являются представителями этих диких анатолийских лошадей.

А примерно в 2000 г. до н.э. наблюдается статистически значимое снижение частот местных митохондриальных линий диких лошадей, поскольку гаплогруппа P становится редкой, а гаплотип X полностью исчезает. Хотя низкая частота гаплотипа X у лошадей отмечена ещё до бронзового века.

Параллельно с этим, разнообразие материнских линий у лошадей Кавказа и Анатолии заметно возросло от 2 до 14, т.е. уровня современных, а также лошадей эпохи энеолита, халколита и ранней бронзы из Юго-Восточной Европы и Казахстана.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

В исследованиях лошадей Евразийской степи, митохондриальные гаплогруппы не демонстрируют филогеографической структуры в Евразии, что согласуется с отсутствием значительных физических барьеров в обширных евразийских степях. Это предполагает, что у популяций лошадей степи был постоянный обмен генетической информацией между её членами, что, вероятно, объясняет высокое разнообразие современных популяций домашних лошадей. Это также объясняет быстрый рост разнообразия, наблюдаемый в наборе данных из этого исследования при внедрении лошадей на Кавказ и в Анатолию. Это внезапное появление неместных родословных совпадает с появлением иконографических и эпиграфических свидетельств о лошадях и верховой езде в конце третьего тысячелетия до нашей эры и свидетельствует о значительном импорте домашних форм и, следовательно, против независимого местного процесса одомашнивания. Результаты, полученные при генотипировании аллелей, связанных с вариациями в цвете шерсти, подтверждают этот вывод, поскольку лошади бронзового века в Анатолии и на Кавказе демонстрируют мутации, соответствующие вариантам окраски шерсти, которые, как считается, были выбраны во время одомашнивания в евразийских степях, например, каштановый, чёрный и серебристый.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

А мутации, связанные с разбавлением цвета шерсти или пятнами, появились позже, после 1200 г. до н.э. согласно данным исследования. Таким образом, исходя из новых генетических данных, исследователи делают вывод, что домашние лошади, завезённые в Анатолию в бронзовом веке, несли мутации, обнаруженные ранее в Северной Евразии и, следовательно, полученные преимущественно от лошадей из этого обширного региона. Хотя окончательное географическое происхождение этой неместной популяции невозможно определить с помощью имеющихся данных, евразийские степи к северу от Чёрного моря кажутся наиболее вероятным кандидатом. Однако местный анатолийский гаплотип P сохранялся у домашних лошадей бронзового века Анатолии и Кавказа, а также у современных лошадей, правда с низкой частотой, около 8%. А это позволяет предположить, что дикие анатолийские лошади, вероятно, часто включались в стада домашних, вскоре после появления их регионе и исчезновения в дикой природе. Результаты свидетельствуют о быстром переходе от охоты к скотоводству после появления домашних лошадей в раннем бронзовом веке, что, вероятно, коррелирует с окончательным сокращением популяции диких лошадей в Анатолии и на Кавказе, на что указывает низкая частота их останков. Схожая картина с двумя гаплотипами Y-хромосомы, Y-HT-1 и Y-HT-3, Анатолии и Кавказа, намекает на возможность популяционной динамики, подобной той, что зафиксирована для Северной Евразии, где преобладающий Y-гаплотип –Y-HT-1 у современных лошадей, заметно увеличился после начала одомашнивания, достигнув фиксации в генофонде к средневековью, в то время как Y-HT-3 снижался с течением времени вплоть до своего исчезновения.

В Анатолийском наборе данных из этой работы оба гаплотипа встречались с сопоставимой частотой около 2000 года до н. э., но и здесь частота Y-HT-3 со временем уменьшилась, а самая последняя лошадь, которая несла Y-HT-3, была родом с Кавказа, возрастом около 3300 лет. Это уменьшение разнообразия Y-хромосом, по-видимому, является результатом сильного отбора жеребцов.

Поскольку северная Евразия, и в частности Причерноморско-Каспийская степь, в настоящее время является наиболее вероятным местом происхождения домашних лошадей, завезённых в Анатолию, существует два возможных маршрута: один через Юго-Восточную Европу и один через Кавказ. Маршрут через Босфор был предложен на основе самых ранних зооархеологических свидетельств существования домашних лошадей на южных Балканах на стоянке раннего бронзового века Канлигечит около 2600–2300 гг. до н. э. Окрасы шерсти 10 лошадей с этого участка были генотипированы и выявили сильно смещённое распределение мутаций окраса шерсти у 6 из 10 гомозиготных черных лошадей, 4 из которых также показывают "пятнистость леопарда" ещё у 2 гнедых лошадей с пятнистостью, мутаций каштанового цвета не обнаружено. Эта картина сильно контрастирует с новыми данными из Анатолии и Кавказа, где каштановый цвет является самым ранним вариантом окраски шерсти, в то время как черные и леопардовые окрасы остаются очень редкими (только 2 из 25).

Эти различия служат аргументом против введения популяции домашних лошадей, аналогичной той, что была обнаружена в Канлигечите. Более того, нет никаких археологических данных о коневодстве в Западной Анатолии в третьем тысячелетии до нашей эры, что не даёт дополнительной поддержки гипотезе о раннем вводном пути через Босфор.

Напротив, новая идентификация нескольких неместных митохондриальных линий и мутаций, связанных с окрасом шерсти, широко появляющихся одновременно на Южном Кавказе и в центральной Анатолии, свидетельствует в пользу пути распространения через Кавказ. Наличие костей и изображений лошадей в поселениях майкопской культуры и погребениях около 3300 г. до н.э. на Северном Кавказе привело к предположению, что практика верховой езды началась в майкопский период. Кроме того, недавние исследования геномов людей того же периода показали непрерывный поток генов между степями медного века и народами Кавказа, а позже, в эпоху бронзы, между Месопотамией, Анатолией, Южным и Северным Кавказом, а также степью. Этот обмен между группами людей, похоже, усиливается с началом похолодания и засухи 4200 лет назад, что могло повлиять на стратегии выживания и социальные сети в степной зоне.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Согласно имеющимся данным, это климатическое событие, по-видимому, в значительной степени совпало с появлением неместных митохондриальных гаплогрупп и сменой окраса шерсти лошадей на Кавказе и в Анатолии. Что также связано с распространением коневодства и, возможно, индоевропейских языков. Хотя культурные процессы, инициировавшие распространение коневодства к югу от Кавказа, в настоящее время трудно поддаются анализу, они могут быть связаны с перемещением людей через Кавказ в Анатолию, начиная с конца третьего тысячелетия до нашей эры.

Древний мул

Среди образцов из новой работы попался и мул, а именно потомок лошади и осла, из контекста раннего железного века, в Чадир-Хююк Центральной Анатолии, датируемого 1100–800 гг. до н. э. Из данного региона это первое свидетельство мулов, помимо европейского железного века и римского периода. При этом, учитывая, что гаплогруппа кобылы была неместной, получается, что гибрид был от домашних животных. При этом кобыла передала мулу два мутантных аллеля цвета шерсти. Хотя это и не является чем-то удивительным, присутствие мула в железном веке Анатолии отражает новую роль домашних лошадей, появившуюся по мере их распространения в регионе, где домашние ослы использовались с четвёртого тысячелетия до нашей эры. Однако этот случай является ранним примером преднамеренной гибридизации. Будучи самым дорогим видом, упомянутым в ценах на домашний скот хеттского периода от ~ 1600 до ~ 1178 г. до н. э., мулы, вероятно, ценились очень высоко.

Помимо лошадей, результаты нового исследования недвусмысленно свидетельствуют о том, что люди неолита, энеолита и бронзового века Анатолии также охотились на европейских плейстоценовых ослов, которые когда-то населяли большую часть Анатолии. Таким образом, объединённые данные предполагают, что ослы вымерли в Анатолии в эпоху поздней бронзы более или менее одновременно с местными дикими лошадьми, возможно, в ответ на ту же комбинацию факторов, включая повышенную засушливость, связанную с засухой 2100-х годов до н. э., а также конкуренцию за пастбищные ресурсы с растущим количеством скота и, вероятно, из-за охоты элит.

Выводы

В новой работе, охватывающей ~ 9000 лет голоцена, были проанализированы митохондриальные линии древних лошадей из Южного Кавказа и Анатолии. Исследование позволило проверить гипотезу о том, что Анатолия была центром одомашнивания лошадей. Авторам работы удалось идентифицировать митотипы, характерные для местных диких лошадей Анатолии, которые регулярно использовались в раннем и среднем голоцене. При этом генетический анализ показал, что неместные генетические маркеры, которые все ещё присутствуют у домашних лошадей, появились в регионе не постепенно, а внезапно после ~ 2000 г. до н.э. Исследование также демонстрирует, что у этих завезённых домашних лошадей окрас отличался от местных до приручения. Однако материнская линия P, выявленная у местных лошадей до приручения, присутствует и в бронзовом веке, что подразумевает ограниченное включение местных кобыл в домашние стада.

В целом результаты указывают на то, что домашние лошади были завезены в Анатолию, возможно, через Кавказ в период бронзового века, и дают дату начала эксплуатации домашних лошадей в Анатолии и Закавказье около 2000 года до н. э. Данные также свидетельствуют против местного независимого приручения лошади в этом регионе. Новые результаты убедительно указывают на то, что Анатолия не была основным источником происхождения домашних лошадей, но, как наблюдалось и в других регионах, местные материнские линии всё же были включены в стада неместных домашних лошадей, которые также были скрещены с местными ослами для создания мулов. Однако точное географическое происхождение завезённых лошадей ещё предстоит определить.

Источник: Ancient DNA shows domestic horses were introduced in the southern Caucasus and Anatolia during the Bronze Age
Silvia Guimaraes, Benjamin S. Arbuckle, Joris Peters, Sarah E. Adcock, Hijlke Buitenhuis, Hannah Chazin, Ninna Manaseryan, Hans-Peter Uerpmann, Thierry Grange, and Eva-Maria Geigl doi.org/10.1126/sciadv.abb0030
Показать полностью 11
4119

Доступно о генетике

Генетика у обывателей: Ну дед и дядя болели, значит, и ты будешь.

Генетика в школе: Есть два гороха - жёлтый и зелёный.

Генетика в меде: Двойной кроссинговер, AaBBCc vs aaBbCc с кроссинговером в 37%, сучка, экспрессия-репрессия-депрессия-сессия-хуессия, mother fucker!!

Генетика во врачебной практике: Ну дед и дядя болели, значит, и ты будешь.


Доступно о генетике Биология, Генетика, Картинки, ДНК, Юмор
731

Первая в мире искусственная жизнь создана

Крейг Вентер, который десять лет назад первым прочитал геном человека, только что создал первый рукотворный геном и вживил его в клетку. Так человечество перешло от чтения геномов к их написанию.

Ученым впервые удалось создать искусственный геном и заставить живую клетку жить с этим генетическим кодом.

Команда исследователей под руководством Крейга Вентера химическим путем синтезировала геном бактерии Mycoplasma mycoides и вставила его в клетку другого микроорганизма — Mycoplasma capricolum, из которой перед этим были удалены все гены. Полученный «франкенштейн» ожил, стал размножаться и вообще повел себя как обычная бактерия Mycoplasma mycoides. Описание этой замечательной работы опубликовано в четверг в журнале Science.

До сих пор ученые умели только «читать» ДНК живых существ, а вот создать геном de novo (заново) еще никому не удавалось. Получение искусственного организма имеет не только научный интерес, но даже философский: создав жизнеспособное существо с использованием искусственной ДНК, ученые наглядно доказали, что жизнь можно получить из десятка баночек с реактивами. Теоретически этот тезис всем очевиден, но на практике никто никогда его напрямую не подтверждал.

Прежде чем рассказать о деталях незаурядного эксперимента Вентера и коллег, стоит напомнить, кто такой Крейг Вентер. Это своего рода медийная звезда, исследователь, известный не только в биологических кругах, но и широкой публике: впервые его имя зазвучало на рубеже нового тысячелетия, когда вовсю осуществлялся проект «Геном человека» — ученые всего мира коллективными усилиями пытались определить последовательность ДНК Homo sapiens.

Несмотря на все старания, работа продвигалась медленно — проект стартовал в 1990 году, и за девять лет была целиком расшифрована всего одна маленькая хромосома. Вентер и специалисты созданной им компании Celera Genomics усовершенствовали технологии работы с ДНК и подключились к «Геному человека». В 2001 году черновая расшифровка генома была наконец завершена.

На расшифровке генома человека основатель Celera Genomics не остановился — его следующим амбициозным проектом (а Вентера интересуют только амбициозные проекты) стало создание организма с синтетическим геномом.

Казалось бы, ничего сложного здесь нет: надо лишь воссоздать уже известную нам последовательность букв генетического кода и вставить ее в подходящую клетку. Но на самом деле на этом пути исследователи сталкиваются со множеством трудностей — не в последнюю очередь потому, что пока ученые доподлинно не знают всех особенностей работы генома как комплексной системы. Это не просто цепочка букв. Нить ДНК каждого организма снабжена навешанными на нее молекулами-«маячками», так называемыми эпигенетическими маркерами, без которых считывание генома будет проходить некорректно. На то, чтобы научиться вносить в искусственный геном Mycoplasma mycoides необходимые маркеры, у исследователей ушел не один год.

Эксперимент по созданию жизни был спланирован так: ученые синтезируют геном какой-нибудь бактерии (назовем ее бактерией-донором, так как она дает исследователям последовательность своей ДНК) и вставляют его в клетку бактерии другого вида, из которой предварительно удаляют собственный геном (это будет бактерия-реципиент). Если получившийся организм живет, питается и размножается, а также в точности напоминает донорные бактерии, а не бактерии-реципиенты или что-то промежуточное, то эксперимент удался.

В качестве донора ученые выбрали бактерию-паразита Mycoplasma mycoides, отчасти из-за того, что у нее очень маленький геном — всего около миллиона «букв» (для сравнения: в геноме человека их 3 миллиарда). Реципиентом выступала родственная бактерия Mycoplasma capricolum. Самой сложной частью эксперимента был синтез целого бактериального генома: современные технологии не позволяют за раз получать такие длинные цепи. Чтобы преодолеть эту трудность, ученые синтезировали небольшие «кассеты» из ДНК, содержащие только часть генома Mycoplasma mycoides, а затем соединяли их вместе. Пока самым эффективным инструментом для объединения «кассет» являются живые организмы — никакие химические ухищрения не позволяют делать это столь же точно. Исследователи как мозаику складывали геном Mycoplasma mycoides сначала в клетках кишечной палочки, а потом, когда им удалось получить достаточно крупные куски ДНК, в клетках дрожжей.

В итоге им удалось по кусочкам собрать весь геном. «Запихнуть» его в очищенную от ДНК клетку бактерии-реципиента также было нетривиальной задачей.

Полученные бактерии-гибриды выглядели так же, как Mycoplasma mycoides, росли так же, как Mycoplasma mycoides, поглощали питательные вещества так же, как Mycoplasma mycoides, и размножались так же. Чтобы дополнительно убедиться в успехе эксперимента, ученые выделили из гибридных клеток белки, разделили их на фракции и сравнили полученную картину с тем, что получается при выделении белков из обычной Mycoplasma mycoides. Получилось то же самое. Сейчас созданные исследователями бактерии растут в лаборатории и ничем не отличаются от своих соседей из чашки Петри.

Читатель может спросить, а в чем же глубинный смысл экспериментов Вентера? Что дадут человечеству искусственно созданные бактерии?

Авторы статьи объясняют суть своей работы так: отработанная ими технология получения жизнеспособных организмов, геномы которых созданы искусственно, в будущем позволит не только делать копии уже существующих в природе живых существ, как сегодня сделал Вентер, но и создавать абсолютно новые организмы, которые не входили в генеральный план Создателя, или природы, или эволюции — как хотите.

И речь не обязательно идет о каких-то неведомых чудищах: имея на руках работающую методику, можно переписывать генетическую программу привычных организмов таким образом, чтобы они сочетали в себе максимальное число полезных признаков. Можно создать абсолютно новый организм, который, например, одновременно давал бы молоко, синтезировал антибиотики и при этом представлял собой всего лишь культуру клеток в пробирке.

https://snob.ru/selected/entry/18858/
Показать полностью
192

Генетический вариант, повышающий риск тяжелого протекания COVID-19, унаследован от неандертальцев

Генетический вариант, повышающий риск тяжелого протекания COVID-19, унаследован от неандертальцев Наука, Генетика, Палеогенетика, Копипаста, Elementy ru, Коронавирус, Вирус, Неандерталец, Homo sapiens, Длиннопост

Рис. 1. Частота встречаемости неандертальского генетического варианта, повышающего риск тяжелой формы COVID-19. В Африке и Восточной Азии «аллель риска» практически отсутствует, а максимальная частота наблюдается в Южной Азии, особенно в Бангладеш. Рисунок из обсуждаемой статьи в Nature (по данным проекта The 1000 Genomes Project)


На сегодняшний день генетикам удалось выявить только один участок человеческого генома, нуклеотидные вариации в котором значимо влияют на шансы заболеть тяжелой формой COVID-19. Этот фрагмент третьей хромосомы длиной около 50 тысяч пар оснований встречается у современных людей в нескольких вариантах, один из которых повышает шансы попасть в больницу с тяжелой формой COVID-19 примерно в 1,6 раз. Палеогенетики Сванте Пэабо и Хуго Цеберг показали, что этот «аллель риска» имеет неандертальское происхождение. Вместе с другими неандартальскими генами он попал в генофонд внеафриканских сапиенсов в результате гибридизации, которая происходила около 50 тысяч лет назад. Частота встречаемости «аллеля риска» сильно варьирует в зависимости от региона: в Африке и Восточной Азии она близка к нулю, в Европе составляет 8%, в Южной Азии — 30%. Столь большие различия говорят о том, что в не очень далеком прошлом аллель подвергался сильному отбору, иногда положительному, иногда отрицательному. Скорее всего, это связано с тем, что аллель влияет на устойчивость к каким-то другим патогенам помимо нового коронавируса.

Как известно, COVID-19 — болезнь избирательная: кто-то заболевает, кто-то нет, одни переносят легко, другие — тяжело, вплоть до летального исхода. Это зависит от множества негенетических факторов, среди которых особенно важны возраст, пол и наличие определенных заболеваний. Логично предположить, что и генетические различия между людьми тоже вносят свой вклад в наблюдаемый разброс по восприимчивости к COVID-19 и тяжести протекания болезни.

Несмотря на усердные поиски, на сегодняшний день генетикам удалось идентифицировать только один участок человеческого генома, связь которого с риском заполучить тяжелую форму COVID-19 не вызывает никаких сомнений. Этот участок расположен на третьей хромосоме и включает гены SLC6A20, LZTFL1, CCR9, FYCO1, CXCR6 и XCR1. Его влияние на устойчивость к новой инфекции сначала было обнаружено при помощи полногеномного поиска ассоциаций (GWAS) на основе данных по 835 больным и 1255 здоровым итальянцам и 775 больным и 950 здоровым испанцам. Это исследование проводилось во время весеннего пика заболеваемости в Европе (D. Ellinghaus et al., 2020. Genomewide Association Study of Severe Covid-19 with Respiratory Failure).

В дальнейшем результат успешно воспроизвелся в нескольких независимых исследованиях на других европейских и азиатских выборках. Метаанализ, проведенный в рамках проекта COVID-19 Host Genetics Initiative, окончательно подтвердил, что один из вариантов этого участка генома («аллель риска»), характеризующийся определенными нуклеотидами в 13 полиморфных позициях, повышает шансы человека оказаться в больнице с тяжелой формой COVID-19 примерно в 1,6 раз (это несколько упрощенная формулировка, речь идет об отношении шансов, см. Odds ratio, которое, по результатам метаанализа, составляет 1,6 с 95-процентным доверительным интервалом от 1,42 до 1,79). По-видимому, этот генетический вариант повышает и шансы подцепить умеренно тяжелую форму COVID-19 (частота этого варианта выше у людей, госпитализированных с COVID-19, чем в среднем по популяции), и риск очень тяжелого протекания болезни среди уже заболевших (среди госпитализированных пациентов, которым потребовалась искусственная вентиляция легких, частота этого варианта выше, чем у тех, кто обошелся только дополнительным кислородом).

Упомянутые 13 полиморфных позиций разбросаны по участку хромосомы длиной около 50 тысяч пар оснований. При этом нуклеотидные варианты, коррелирующие с повышенным риском тяжелого протекания COVID-19, во всех 13 позициях почти всегда присутствуют все вместе, дружно, образуя единый гаплотип. Иными словами, для них характерно то, что генетики называют «неравновесным сцеплением» (см. Linkage disequilibrium).

Именно такая картина — несколько прочно сцепленных полиморфизмов, расположенных по соседству, — характерна для фрагментов ДНК, полученных предками современных людей от неандертальцев и денисовцев в результате гибридизации.

Поэтому палеогенетики Сванте Пэабо и Хуго Цеберг (Hugo Zeberg) решили проверить, не совпадает ли этот гаплотип с неандертальскими или денисовскими геномными последовательностями. Для этого нужны геномы вымерших видов людей, прочтенные очень качественно, то есть с высоким покрытием. Таких геномов на сегодняшний день четыре: три неандертальских и один денисовский.

Результат получился вполне однозначный: из 13 полиморфизмов, характерных для «гаплотипа риска», 11 присутствуют в гомозиготном состоянии у неандертальца из пещеры Виндия в Хорватии (Vindija 33.19). Три полиморфизма есть у двух других неандертальцев с качественно прочтенными геномами — из Денисовой и Чагырской пещер на Алтае (Denisova 5 и Chagyrskaya 8, см.: Между сапиенсами и неандертальцами существовала частичная репродуктивная изоляция, «Элементы», 03.02.2014; F. Mafessoni et al., 2020. A high-coverage Neandertal genome from Chagyrskaya Cave). В денисовском геноме (см.: Геном денисовского человека отсеквенирован с высокой точностью, «Элементы», 06.09.2012) не оказалось ни одного из 13 полиморфизмов.

Этот результат уже сам по себе является убедительным доводом в пользу того, что «гаплотип риска» унаследован современными людьми от неандертальцев, близких к индивиду из пещеры Виндия. Остальные неандертальские примеси в современных геномах тоже ближе к геному хорватского неандертальца, чем к индивидам с Алтая. Объясняется это тем, что те неандертальцы, с которыми скрещивались вышедшие из Африки сапиенсы 60–50 тысяч лет назад, были более близкой родней хорватского неандертальца, чем алтайских.

Дополнительные тесты подтвердили вывод о неандертальском происхождении «гаплотипа риска». В частности, вероятность того, что такой длинный гаплотип мог быть унаследован хорватским неандертальцем и современными людьми от общего предка, оказалась, по расчетам авторов, пренебрежимо низкой. За более чем полмиллиона лет раздельного существования сапиенсов и неандертальцев гаплотип должен был бы покрошиться на мелкие кусочки из-за кроссинговера. Авторы также построили филогенетическое дерево для всех имеющихся у современных людей вариантов (аллелей) рассматриваемого участка генома. На этом дереве все современные аллели, связанные с повышенным риском тяжелой формы COVID-19 (они отличаются друг от друга лишь единичными нуклеотидными заменами), образовали единую компактную ветвь с хорватским неандертальцем, а сестринскими к этой ветви оказались неандертальские варианты с Алтая. Иными словами, «аллель риска» (во всех его незначительных вариациях) ближе к любому из трех неандертальских вариантов, чем к любому другому варианту этого участка генома, встречающемуся у современных людей. Таким образом, неандертальское происхождение «гаплотипа риска» доказано вполне надежно.

Частота встречаемости неандертальского «гаплотипа риска» в современных человеческих популяциях сильно варьирует в зависимости от региона (рис. 1). Его практически нет в Африке, что логично, поскольку приток неандертальских генов в генофонд современных африканцев, живущих к югу от Сахары, был незначительным (и, вероятно, непрямым). Почти нет его и у жителей Восточной Азии (китайцев, японцев). Это неожиданный результат, потому что других неандертальских генов у восточноазиатов немало — даже чуть больше, чем у европейцев. В Европе неандертальский гаплотип встречается с частотой около 8%, в Южной Азии — 30%. Наибольшая частота характерна для Бангладеш: 63% жителей этой страны несут по крайней мере одну копию неандертальского гаплотипа, а 13% — две копии (то есть являются гомозиготами), что дает общую частоту 13 + (63 − 13)/2 = 38%. Это согласуется с тем, что в Великобритании, по официальным данным, шансы умереть от COVID-19 у выходцев из Бангладеш примерно вдвое (95% доверительный интервал: 1,7–2,4) выше, чем у белых британцев. У выходцев из других стран ситуация заметно лучше, чем у бангладешцев.

Объяснить, почему в Восточной Азии частота встречаемости неандертальского гаплотипа почти нулевая, а в Южной — очень высокая, по-видимому, можно только сильным отбором, который действовал по-разному в разных регионах. Логично предположить, что главным фактором отбора были какие-то патогены. Может быть, неандертальский гаплотип, снижающий сопротивляемость новой короновирусной инфекции, подвергался отрицательному отбору в Китае во время каких-то прежних эпидемий, вызванных другими коронавирусами, а в дельте Ганга на него действовал положительный отбор, потому что он обеспечивал защиту от каких-то других патогенов. Но пока все это — только домыслы, потому что неизвестно, какие именно особенности неандертальского гаплотипа ответственны за повышенный риск тяжелого протекания COVID-19 и каков механизм их действия. Как уже говорилось, в состав гаплотипа входит шесть генов, среди которых не удается однозначно определить кандидата на роль главного фактора риска. Им может оказаться, например, ген SLC6A20, потому что белок, кодируемый этим геном, взаимодействует с белком ACE2 — «входными воротами» нового коронавируса. Не сняты подозрения и с генов CCR9 и CXCR6, потому что они кодируют рецепторы хемокинов, причем работа второго из них имеет прямое отношение к иммунным процессам в легких, например, при гриппе.

Когда-нибудь, возможно, мы узнаем, от каких патогенов защищал этот гаплотип неандертальцев (а также предков нынешнего населения Южной Азии), но пока фантазировать об этом рано. Одно можно сказать наверняка: в 2020 году с некоторыми нашими современниками неандертальское наследие сыграло злую шутку.


Источник: Hugo Zeberg & Svante Pääbo. The major genetic risk factor for severe COVID-19 is inherited from Neanderthals // Nature. 2020. DOI: 10.1038/s41586-020-2818-3.


См. также: Неандертальские гены влияют на здоровье современных людей, «Элементы», 20.02.2016.


Александр Марков


https://elementy.ru/novosti_nauki/433709/Geneticheskiy_varia...
Показать полностью
5912

Новость №1101: Международная комиссия по клиническому применению генетического редактирования разрешила генетически редактировать детей

Новость №1101: Международная комиссия по клиническому применению генетического редактирования разрешила генетически редактировать детей Образовач, Комиксы, Наука, Генетика, Трансгуманизм, Геном, Редактирование генома

https://nplus1.ru/material/2020/09/23/whoedits

98

Как укладка ДНК в клетке может вызывать наследственные болезни

В последние годы в генетике сформировался новый взгляд на геном: не просто цепочка генов, а трехмерная сеть, архитектура которой играет важную роль в реализации информации, заложенной в ДНК. Изучением и моделированием того, как молекула ДНК располагается внутри клеточного ядра и как это влияет на вероятность развития ряда наследственных заболеваний, занимаются сотрудники сектора геномных механизмов онтогенеза ФИЦ ИЦиГ СО РАН. Ряд результатов их работы был представлен на XII международной мультиконференции «Биоинформатика и системная биология» (BGRS/SB-2020). Подробности об этой работе в нашем интервью с руководителем сектора, к.б.н. Вениамином Фишманом.

Как укладка ДНК в клетке может вызывать наследственные болезни Академгородок, ДНК, Генетика, Наследственные болезни, Копипаста, Длиннопост

– Расскажите, в чем заключается цель проводимых Вашей группой исследований 3D-моделей генома человека?

– Когда в геноме возникает какая-то поломка, мутация, которая ведет к развитию патологии, возникает вопрос – по какому пути протекает этот процесс. Если мутация затрагивает какие-то кодирующие участки ДНК, отвечающие за синтез белка, то все, в принципе, очевидно: вот причина, а вот – ее следствие. Но когда мы имеем дело с какими-то крупными перестройками, которые не затронули белок-кодирующие гены, все становится намного сложнее. Потому что не ясно, если все белки остались те же самые, то что вызвало болезнь? Так родилась гипотеза, которая потом была подтверждена в ряде работ разных исследователей, что само изменение 3D-организации генома (то, как цепочка ДНК укладывается в ядре клетки) влияет на работу генов и количество того или иного белка, который синтезируется в клетке. Отсюда и вытекает наша цель – смоделировать, как уложен геном в известных случаях хромосомных перестроек и, следующий шаг, понять, как это влияет на работу генов и синтез белка.

– Как Вы строите эти модели?

– Есть два класса моделей. Физические модели удобны тем, что в них можно заложить какие-то биофизические параметры. Например, в такой модели ДНК может гнуться, протягиваться. Причем, все это обусловлено довольно простыми физическими законами, которые изучают в рамках школьной программы. Проблема в том, что есть очень много биофизических параметров, которые надо учитывать при создании модели: насколько легко изгибать ДНК, насколько сильно воздействие электростатического отталкивания и так далее. Но их очень сложно измерить, поскольку сама ДНК находится глубоко в ядре клетки, там все организовано не так, как мы можем воссоздать, условно говоря, «в пробирке». Поэтому физические модели замечательны с точки зрения понимания каких-то механизмов, но часто неприменимы для реальных задач, поскольку мы не можем создать полную картину для какого-то конкретного варианта мутаций, только описать общие принципы связи архитектуры генома и его работы.

– Есть какой-то выход?

– Конечно. В своей работе мы чаще используем второй тип моделей, построенных методом «черного ящика». В его основе лежит машинное обучение: мы измеряем в эксперименте те свойства ДНК, которые можем, и загружаем их в компьютер. А дальше машина сама находит взаимосвязи между известными нам параметрами и разными вариантами укладки ДНК, которых тоже известно немало. Конечно, мы не можем таким образом понять, как именно последовательности на разных участках генома связаны с физическими свойствами ДНК. Физики их тестируют, но у них в среднем на одну такую взаимосвязь уходит года три, а их существует множество. То есть, это работа на века, по крайней мере, при нынешних темпах развития науки. Поэтому пока мы просто ищем такие взаимосвязи, фиксируем результат, пусть даже не понимая до конца, почему он получился именно таким. И для этого метод «черного ящика» очень хорошо подходит, потому что он выдает очень точные ответы с точки зрения практики.

– То есть, Вы видите, что получилось, пусть не всегда понимая, почему именно так, а не иначе?

– Можно сказать и так, хотя есть и какие-то взаимосвязи, которые мы можем понять. Например, поменять одну букву в последовательности ДНК и посмотреть, как наш черный ящик в ответ изменит укладку. Да, полная цепочка событий нам по-прежнему неизвестна, но мы можем с уверенностью говорить, какие участки ДНК более важны, какие – менее в данном сценарии. А потом, рассмотрев биологические функции этих участков, сформулировать гипотезу о том, как они вовлечены в этот сценарий. И уже на основе этого – переходить к созданию физической модели. Но все же, мне кажется, основная прелесть моделей второго типа как раз в том, что они дают достаточно точный результат, даже когда мы не изучили сам механизм его получения.

– Вы сейчас говорите о прогнозе развития у человека какой-то конкретной наследственной патологии?

– Совершенно верно, но не только об этом. Есть еще одно направление, я называю его методическим. Мы говорим о довольно сложных вещах: 3D-укладка генома, белки садятся, ДНК гнется, все это имеет сложную систему связей. Но есть очень простой вывод, когда случается хромосомная перестройка, меняется укладка, и по этим изменениям можно предсказывать риск развития наследственного заболевания. Причем, это недавняя история, еще несколько лет назад никто не смотрел на организацию ДНК у таких людей, просто искали изменения в линейной последовательности. Теперь же, в силу прогресса способов исследования ДНК, подход вообще можно кардинально развернуть: предсказать эти линейные перестройки на основе информации о том, как ДНК уложена в ядре. Это, по сути, новый метод изучения наследственных заболеваний, который мы сейчас тоже развиваем. Конечно, мы не одни, и даже – не первые, такие идеи бродят года с 2012-го. Но, обычно, стараются предсказывать на основе укладки крупные перестройки, а мы разрабатываем метод, который, при определенных изменениях протокола, позволит посмотреть и на точечные полиморфизмы. А это совсем другой диагностический подход. Раньше совместить оба подхода в рамках одного метода никому особо не удавалось, изучали либо крупные перестройки, либо искали точечные мутации. Это проблема, потому что пациенту надо, по-хорошему, делать два дорогостоящих анализа. И часто, если во время первого анализа что-то находили, то второй просто не делали, а может, основная причина была как раз там. Если у нас получится совместить оба подхода в рамках одного анализа, это будет очень важно. Предварительные результаты, которые мы представили на конференции BGRS/SB-2020, внушают оптимизм.

– А с точки зрения пациента, какая от этого польза? Ведь если причина болезни в мутации ДНК, то современная медицина все равно не сможет ее вылечить.

– Для пациента есть два важных нюанса. Первый – дать родителям возможность понять, какой из вариантов генома приводит или может привести к появлению заболевания у их детей. Можно определит, от кого из родителей ребенку достался этот вариант. И если родители прибегнут к процедуре ЭКО, можно, используя наш метод, выбрать эмбрион без «плохой» мутации в геноме. Проще говоря, родить здорового ребенка. Второй нюанс относится к людям, которые уже родились с каким-то наследственным заболеванием. К сожалению, такие болезни пока не поддаются полноценному лечению, но, зная на раннем этапе о мутации, которая вызывает заболевание, в ряде случаев можно предложить стратегии его сдерживания, поддержания более комфортного уровня жизни. А там, где это пока невозможно, даже сам точный прогноз, как и в какие сроки все будет протекать – как мне кажется, нужная для родителей вещь. Потому что такое случается, и родителям важно понимать, что их ждет и что дальше делать.

Источник

Показать полностью
81

Происхождение цыган (генетическая история европейских цыган)

Цыгане — это преимущественно кочующая индоарийская этническая группа, без собственной письменной истории, однако за 15 веков распространившаяся, по обширным территориям. Наибольшее их количество сосредоточено в регионах Восточной и Центральной Европы, но они в большом количестве живут на Пиренейском полуострове, а также на Кавказе, Ближнем Востоке и в Америке. Точное количество цыган трудно оценить из-за отсутствия надежных методов переписи, поэтому в разных источниках данные варьируются от 4 до 15 млн. человек. Сразу отмечу, что у описываемых групп людей есть различные самоназвания, да и разные народы их также называли по-разному. Также акцентирую внимание на том, что речь в данном видео преимущественно о европейских популяциях цыган. Почти не касаясь цыган – дом, лом, люли и других.

Сравнительная лингвистика помещает родину европейских цыган в Индии, особенно в северо-западном регионе, поскольку цыганский язык тесно связан с пенджабским и кашмирским. Однако социальная организация и культурная динамика в индийских популяциях такова, что люди, проживающие в тесно связанных языковых группах и даже в одном и том же регионе, имеют разные пропорции генетических компонентов, связанных с предками южных и северных индийцев. Что не позволяет рассматривать их как генетически однородные группы и затрудняет поиск происхождения цыган, основанный исключительно на лингвистических данных.

Индийская генетическая составляющая цыганской популяции была впервые предложена после выявления общих болезнетворных мутаций у индийских и пакистанских пациентов. Анализ однополых маркеров позволил установить индийское происхождение некоторых материнских и отцовских линий, обнаруженных у цыган. Это относится к линиям М5, М18, М25, М35, митохондриальной гаплогруппы M и к линии М69 гаплогруппы Y-хромосомы Н.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Кроме того, общегеномные исследования показывают, что европейские цыгане происходят от уменьшенного числа популяции-основателей или протоцыган, прародиной которых был нынешний штат Пенджаб на северо-западе Индии.

Согласно предыдущим историческим и антропологическим свидетельствам, предковые популяции цыган мигрировали из Северо-Западной Индии на Балканский полуостров, через Персию, Армению и Малоазиатское нагорье, примерно в IX-X веке нашей эры. А в XI-XII веке некоторые цыгане расселились по Балканскому полуострову, образовав соответственно балканских цыган. Другие группы распространились по Дунайским княжествам (современная Румыния, Молдова и Венгрия), где их принудили к рабству, так получились цыгане-влахи.

Под влахами (Vlax Roma) в данном случае подразумеваются группы цыган, говорящие на влашских диалектах цыганского языка

А группы будущих карпатских цыган или ромунгров, рассеялись по всей Австро-Венгерской империи. И наконец, другие небольшие группы переселились в Северную, Центральную и Западную Европу (северо-западные цыгане). Прибытие цыган на Пиренейский полуостров в начале XV века, подтверждается рядом иберийских исторических записей, упоминающих о присутствии цыганских групп в Сарагосе и Барселоне в 1425 и 1447 годах соответственно.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Выше описана довольно упрощённая модель, а в целом распространение цыган по Ближнему Востоку, Кавказу и Европе было очень сложным процессом, в ходе которого цыганские популяции получали существенные потоки генов из различных европейских, ближневосточных и кавказских, нецыганских популяций. Помимо этого, обмен генами происходил и между генетически отличающимися популяциями цыган. Общегеномные данные показали, что у цыган до 80% западноевразийских предков (с учётом популяций Ближнего Востока и Кавказа), в то время как остальные 20% происходят из южноазиатских источников. Однако здесь стоит учитывать, что часть западноевразийского компонента, до 15%, уже присутствовала в Южной Азии задолго до формирования прото-цыганских популяций, ещё около 4 тыс. лет назад в виде предков северных индийцев. Более подробно описано в ролике: Популяционная история Центральной и Южной Азии по данным древней ДНК.

Также хочу обратить внимание зрителей, на то, как генетически изменялись популяции цыган всего за полторы тысячи лет, несмотря на практики заключения браков в пределах своей группы. Ведь в итоге цыгане состоят из разнородной и субструктурированной мозаики популяций, которые демонстрируют культурно-исторические и лингвистические различия не только с соседними популяциями, но и между собой. Это может быть хорошим примером, для некоторых людей, представляющих популяции с эндогамными социальными практиками, как что-то единое и неизменное в генетическом плане на протяжении тысяч лет. Это любителям великих предков на заметку.

При этом эндогамия приводит к различному спектру наследственных заболеваний, что и отмечено у цыган, по сравнению с другими популяциями. Поскольку географически рассредоточенное кочевое население было социально изолировано, а также часто подвергалось преследованиям начиная со Средневековья и до наших дней.

Исторические записи подтверждают преследование и социальную маргинализацию, которой подвергались популяции цыган с момента прибытия в Европу. Также предпринимались попытки их насильственной ассимиляции, например, в Габсбургской монархии или Норвегии с XVIII по XX века, а также в СССР.


Структура популяции цыган


Образцы цыган из разных исследований, на графике анализа главных компонент расположились между европейцами и популяциями Южной Азии, в соответствии с их южноазиатским происхождением и последующем смешением с европейцами.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Анализ примесей показал два основных компонента предков: западноевразийский и южноазиатский, что еще раз подтверждает южноазиатское происхождение цыган и недавнюю европейскую примесь.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

А при сравнении цыганских групп между собой, исследователи обнаружили четкое разделение между северными и западными группами, испанскими и прибалтийскими цыганами, а также между северо-западными цыганами и другими группами.

Также не обошлось и без сюрпризов для добровольцев, у одного представителя влахов из Венгрии вообще не обнаружилось цыганской родословной, после чего этот образец ДНК был удален из последующих анализов.

Кстати, вопрос: кем считать этого человека, если он сам считает себя цыганом?


Формирование цыганских популяций и источники примеси


После того, как популяции прото-цыган покинули территорию Индию были зафиксированы события примеси с европейскими популяциями около 1270–1580 гг. Этот интервал дат вписывается в периоды, когда появляются первые исторические записи о цыган в странах Европы. Более ранние даты примеси из Балканского полуострова и Центральной Европы, они указывают на то, что расселение цыган по Европе происходило через Балканы. В результате примеси с популяциями по пути следования, у цыган от южноазиатского источника осталось только около 35%. При этом по распределению аллелей этот источник схож с пенджабцами из северо-западной Индии и не только, так как пенджабцы генетически неоднородны и не группируются вместе в связи со сложной и неоднородной структурой населения в Индии с различными пропорциями предков южных и северных индийцев. Но большая часть южноазиатского происхождения цыган в основном принадлежит группе лиц из Пенджаба с меньшим западноевразийским компонентом. Также отмечен вклад и от популяций говорящие на дравидийских языках, как народ ирула, к примеру, представители которого также демонстрируют низкие уровни западноевразийского происхождения.

Стоит отметить, что большая схожесть цыган с современными популяциями Пакистана, чем с Северо-Западной Индией, обусловлена потоком европейских генов на эту территорию уже после того, как прото-цыгане покинули Индию. Это также стоит учитывать.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

В целом, эти данные позволяют предположить, что наиболее вероятным представителем южноазиатского происхождения прото-цыган является наследственный источник, описанный как смесь современных южно-азиатских групп с низким западно-евразийским вкладом. Анализ идентичности по происхождению, также указал на Пенджаб как предполагаемый регион происхождения предков цыган в пределах Индийского субконтинента. При этом формирование цыганского населения, происходило как единое событие.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

А среди популяций, которые внесли наибольший свой вклад в генофонд цыган по ходу их движения в сторону Европы, были армяне, а затем турки. При этом, после прибытия цыган в Европу, дальнейших примесей с представителями Ближнего Востока и Кавказа не наблюдалось.

Что касается европейского вклада, то нет никаких свидетельств того, что какие-то отдельные популяции являются источником потока генов в конкретную группу цыган, хотя юго-западные и юго-восточные европейцы, по-видимому, вносят больший вклад. В цыганских группах Балкан и Центральной Европы европейская примесь составляет около 60%, и увеличивается до 80% по мере удаления от Балканского полуострова. Северные и западные цыгане, включают наибольшее количество европейского происхождения. У цыган, мигрировавших в Северную и Юго-Западную Европу, балканский компонент оставил отличительный след, хотя он был сильно переконфигурирован примесью в Балтийском регионе и на Пиренейском полуострове. Демографическая модель предполагает несколько событий генетических расколов в цыганских популяциях. После отделения их от индийских популяций около 1600-2000 лет назад, первый раскол произошел уже на Балканском полуострове между предками балканских цыган и влахов, и группами мигрантов за пределами Балкан (общими предками карпатских и северо-западных цыган). Два более поздних раскола произошли между карпатскими и северо-западными цыганами, а также между балканскими цыганами и влахами.


Изменение эффективного размера популяции цыган на протяжении поколений


Анализируя все группы цыган вместе, исследователи обнаружили, что эффективный размер предковой популяции цыган перекрывался с таковым у северных индийцев, примерно, до 125 поколений назад, в соответствии с происхождением цыган в этом регионе. Однако в последующие годы эффективный размер популяции предков цыган постоянно сокращался и начал отличаться от эффективного размера популяции Северной Индии. При этом группы северных и южных индийцев не продемонстрировали столь резкого сокращения численности населения. Расчёт показал, что минимальный эффективный размер популяции цыган между 1159 и 1333 годом н. э., составлял 871 - 1160 человек, после чего эффективный размер немного увеличился и снова уменьшился в последних поколениях до наших дней.

Но между 570 и 1005 гг. н. э., когда группы цыган покидали Индию, их эффективный размер популяции составлял от 1380 до 6120 человек.


Оценки эндогамии


Цыгане демонстрируют более высокие показатели эндогамии, чем европейцы или северные индийцы, даже невзирая на то, что они сильно смешаны с европейцами.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Степень генетической однородности в геномах цыган сопоставима с популяциями Южной Индии, которые, как известно, следуют культурным традициям по заключению браков между близкими родственниками. Вероятно, что и у цыган браки заключались преимущественно в пределах определённой социальной группы. Также у цыган отчетливо прослеживается эффект основателя или снижение и смещение генетического разнообразия, а также отмечены последующие, так называемые узкие места в виде сокращения генофонда, которые цыгане переживали в своей демографической истории. Единственными двумя группами, которые демонстрируют более высокие показатели эндогамии и инбридинга, чем у цыган, были южноиндийские популяции ирула и веллалар, говорящие на дравидийских языках. А между группами европейских цыган, балканские цыган показали меньшую степень гомозиготности, чем остальные группы цыган. Это может быть объяснено большей численностью цыган в местах, через которые они попали в Европу, а последующие мигранты, испытывали снижение численности популяции после отделения от балканских цыган. А теперь перейдём к последствиям эндогамии.


Наследственные заболевания у цыган


Высокий уровень эндогамии, присутствующий в геноме цыган, возможно, увеличил вероятность переноса вредных мутаций и аллелей. Проще говоря, увеличились риски наследственных заболеваний. Из 48 известных вариантов мутаций, связанных с такими заболеваниями, 11 было обнаружено только у 40 добровольцев из последней работы. При этом 9 вариантов имели европейское происхождение, указывая на основную европейскую составляющую, а два на южноазиатскую. Среди южноазиатских, один вариант rs121918355, связан с первичной врожденной глаукомой. А второй вариант rs104894396, ассоциирован с множеством заболеваний, связанных с потерей слуха и глухотой.

Хочу обратить внимание на этот раздел комментаторов, которые всеми средствами защищают эндогамию в своём обществе, под предлогом: "зато мы знаем своих предков". Посмотрите какой ценой может обойтись иллюзия знания.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Ведь как показывает практика, даже при высоком уровне эндогамии, от генетического состава образующей популяции, может остаться только 20%... И вряд ли представители этих популяций знают кем были эти 80%, Но также нужно понимать, что у разных популяций и условия развития отличаются...


Предпочтения в смешении


Как уже упоминалось, у европейских цыган обнаружено два источника предков: западно-евразийский, включающий европейские, ближневосточные и кавказские популяции, а также южноазиатский, близкий к пенджабцам. При сравнении пропорций предков в Х-хромосомах и аутосомах можно определить какого пола представители вносили больше своего вклада в цыган. По результатам выяснилось, что мужчинам Ближнего Востока и Кавказа нецыганского происхождения, очень приглянулись цыганки. Да и в целом больший вклад нецыганского происхождения у цыган принадлежит мужчинам. Хотя в меньшей степени к цыганам присоединялись и женщины из мест, где они проходили. А среди европейских популяций, наиболее полюбивших цыганок, оказались мужчины Пиренейского полуострова, Прибалтики и Восточной Европы.


Заключение


Демографическая история цыган характеризуется серией узких мест, до 44% от первоначальной численности популяции и примесей до 80%, которые начали происходить, когда прото-цыгане покинули Индию, и продолжались после их прибытия на Балканы, а позже, и в результате расселения по Европе. Примечательно, что сильная примесь у цыган не стерла признаков того, что цыгане испытали сильное сокращение генофонда в начале расселения. Однако эта западноевразийская примесь частично компенсировала предыдущую утрату генетического разнообразия цыган.

Изучение генетического профиля цыган в мировом контексте ставит их между южными азиатами и европейцами, причём ближе к европейцам, что подтверждается и предыдущими данными о примесях. А предки цыган происходят из региона Пенджаб в северо-западной части Индийского субконтинента, несмотря на обнаруженную неоднородность населения в этом регионе, что согласуется и с лингвистическими данными. По разным оценкам, прото-цыгане отделились от населения, говорящего на пенджаби от 2 до 1,5 тыс. лет назад, и позже покинули Индию, через несколько поколений, когда генетически уже стали отличаться от пенджабцев.

Интересно, что несмотря на то, что цыгане считаются изолированной популяцией с частыми случаями сокращения генофонда, расщеплениями и эндогамией, они всё же являются сильно смешанной популяцией со второй родиной на Балканском полуострове, если говорить упрощённо.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Источники:

1. Erica Bianco, Guillaume Laval, Neus Font-Porterias, Carla García-Fernandez, Begoña Dobon, Rubén Sabido-Vera, Emilija Sukarova Stefanovska, Vaidutis Kučinskas, Halyna Makukh, Horolma Pamjav, Lluis Quintana-Murci, Mihai G Netea, Jaume Bertranpetit, Francesc Calafell, David Comas, Recent common origin, reduced population size, and marked admixture have shaped European Roma genomes, Molecular Biology and Evolution, , msaa156, doi.org/10.1093/molbev/msaa156
2. Font-Porterias N, Arauna LR, Poveda A, Bianco E, Rebato E, Prata MJ, et al. (2019) European Roma groups show complex West Eurasian admixture footprints and a common South Asian genetic origin. PLoS Genet 15(9): e1008417. doi.org/10.1371/journal.pgen.1008417
Показать полностью 9
239

Анализ ДНК подтвердил теорию Тура Хейердала

Американским ученым из Стэнфордского университета удалось доказать гипотезу, предусматривающую тот факт, что древние обитатели американского континента совершали путешествия на острова Полинезии

Специалисты получили генетический материал от 807 жителей Французской Полинезии и Колумбии. Образцы генома распространились на пятнадцать индейских групп и семнадцать островов. Эти люди проживают на Тихоокеанском побережье Южной и Северной Америки.

Ученые провели анализы и выяснили, что фрагменты ДНК островитян и индейских групп одинаковы. А это в свою очередь говорит о смешивании культур


"Мы обнаружили идентичные по происхождению сегменты ДНК индейских предков на нескольких Полинезийских островах. Это убедительно доказывает, что было одно общее контактное событие"

Исследователи полагают, что народы могли встретиться приблизительно в 1200-х годах н.э., в период, когда происходило заселение Полинезийских островов. Они считают, что полинезийцы присутствовали в современной Колумбии. Существует вероятность, что индейцы случайным образом на кораблях прибыли на острова.


Возможные контакты между этими регионами были предметом научных споров в течение нескольких десятилетий. Так, в 1947 году норвежский исследователь Тур Хейердал совершил путешествие на плоту из Южной Америки в Полинезию, чтобы продемонстрировать, что подобное было возможно для древних племен

Анализ ДНК подтвердил теорию Тура Хейердала Тур Хейердал, Наука, Исследования, Кон-Тики, Длиннопост, Генетика

Экспедиция на бальсовом плоту "Кон-Тики" в 1947 году


Многие эксперты предполагали, что эти две популяции смешались еще до прибытия европейцев в Южную Америку, хотя между ними пролегали тысячи километров открытого океана. Но прямых доказательств до последнего времени не было.


Предыдущие генетические исследования были посвящены в основном населению острова Пасхи, известного своими гигантскими каменными статуями (моаи), поскольку географически он ближе остальных к материку. Но на самом деле первый контакт, скорее всего, произошел на одном из архипелагов Восточной Полинезии, как и предполагал Хейердал.

Больше об исследовании в статье Генетический анализ показал, что первыми Америку открыли полинезийцы. Достижениями экспедиции Тура Хейердала, как мы помним, помимо доказательства возможности пересечения Тихого океана (Тур, правда, плыл в обратном направлении - из Перу в Полинезию), было невозможность занесения случайным образом тех же кокосовых пальм из Южной Америки на о.Полинезии (сами кокосы в морской воде не сохранялись, а значит уже опровергается мысль о том, что они каким-либо образом приплыли сами), что также говорит о контактах коренных жителей Южной Америки и Французской Полинезии

Анализ ДНК подтвердил теорию Тура Хейердала Тур Хейердал, Наука, Исследования, Кон-Тики, Длиннопост, Генетика
Показать полностью 1
714

Оживший труп

Оживший труп Телегония, Генетика, Наука, Суеверия, Невежество, Длиннопост

"Голову кладя на плаху и выпив мирное вино,

Я правду расскажу про Спарту и про Афины заодно"

(Л.Фейхтвангер)


На одном вполне уважаемом и посещаемом ресурсе вдруг появилась статья о телегонии. Что это полная чепуха, ясно уже школьникам, по крайней мере, не слишком злостно прогуливавшим уроки биологии. Поэтому меня удивило обсуждение того опуса. Вроде бы взрослые, как бы образованные люди пустились в такие рассуждения, что я счел своим долгом возопить, как тот ксендз у Ильфа и Петрова : «Доконд пан идзе?! Опомятайсе, пан!».

Дискуссия привела к тому, что бедная моя голова пошла кругом, и я погрузился в интернет в надежде выудить понимание ситуации на «настоящий момент».

Всплыло нечто такое:

"Законы РИТА запрещают межрасовые браки славянских народов с негроидными, монголоидными, еврееидными. Смешение Крови выше перечисленный народов между собой приводит к деградации, заболеванию крови (СПИД), вырождению всей ветви данного Рода.

Здоровая наследственность нашими предками сохранялась благодаря девственной чистоте невесты, от гулящей девушки хорошего потомства не получишь. Нравственно падшую девушку считали испорченной, не достойной замужества. Когда юноша брал в жёны "порченую" девушку, такое воссоединение называли "браком", а не Семейным Союзом.

Люди Родов Расы Великой должны знать, что мужчина, во время полового контакта, отдаёт женщине энергию одного года своей жизни: энергия трёх месяцев идёт на закрепление Образа Духа и Крови, а энергия девяти месяцев на вынашивание плода. И если мужчина ведёт беспорядочную половую жизнь, то он растрачивает понапрасну свою Энергию Жизни, что приводит к преждевременному старению, облысению. Академик Павлов отмечал, что смерть человека до 150 лет следует считать насильственной. Норма жизни нашего биологического тела 300-400 лет."


И такого было так много, что пришлось объяснять вроде бы взрослым и как бы образованным вещи самоочевидные. Как выяснилось, старался не зря. Узнал о телегонии и о своей персоне много нового и интересного.

Тем более хочется увидеть реакцию на мой труд здешней аудитории.


Итак, телегония.

Словом «телегония» обозначают мифический биологический закон наследования детьми самки признаков её первого самца. Иначе говоря, независимо от того, сколько самцов оплодотворяют самку в течение её жизни, потомство будет похоже на самого первого.

Начало этого суеверия связывают аж с Аристотелем. Авторитет его, достаточно высокий в античности, был вознесен до небес средневековыми схоластами. Соответственно вера во все его ошибки была безоговорочной. Потом это как-то притихло.

На рубеже Х1Х - ХХ веков о телегонии заговорили снова.

Самое забавное, что возрождение интереса к телегонии связано с именем величайшего биолога Чарльза Дарвина. Дарвин в одном из своих трудов привел описание случая с кобылой лорда Мортона.

=======

Она имела 7/8 арабской и 1/8 английской крови и была покрыта (в 1815 году) кваггой(вымершая ныне родственница зебры), без рождения потомства. В 1817, 1818 и 1823 годах эта кобыла была покрыта жеребцом её породы. Рождённые после этого жеребята были похожи (по жесткости шёрстного покрова, гнедой масти, по наличию тёмных пятен и полос вдоль хребта, по плечам и задним участкам ног) на кваггу в такой степени, как если бы они имели 1/16 крови квагги.

=======

Сам Чарльз Дарвин объяснял этот случай известными явлением атавизма – проявлением в потомстве признаков отдаленных предков. Но к широкой публике эта вполне банальная история попала в пересказе известного французского атеиста и слабого биолога Ле Дантека. Сей ученый муж писал: «Нельзя допустить, чтобы побочные дети не имели никаких признаков мужа их матери, если эта последняя хотя бы раз не была оплодотворена им… И ребёнок, родившийся от женщины, у которой ранее было много детей от разных партнёров, может иметь признаки ото всех этих предыдущих (партнёров) отцов.» И понеслось...


Экспериментальной проверке телегония подвергалась множество раз, в том числе и в России, в заповеднике «Аскания- Нова», где скрещивали лошадей и зебр. Были опыты с собаками и голубями в разных странах. Ни разу в строгих экспериментах телегония не наблюдалась.

Тем не менее, «идея пошла в народ». Явления, напоминающие телегонию, время от времени случались , что моментально подхватывалось и применялось для повышения благосостояния коне-, голубе- , собако- и прочих заводчиков. А тако же для пропаганды целомудрия и прочих вечно юных ценностей.


По большому счету, будь эта самая телегония реальностью, на неё молиться надо было бы! Завез в страну одного племенного быка из Аргентины, скажем. Он переимел всех тёлок в пределах досягаемости и готово! Коровы всю жизнь до мясокомбината рожают элитное потомство, какой бы бледной немочью их потом не покрывали.

Так нет же, отказывались скотоводы от таких огромадных сверхприбылей. Совесть у них гипертрофирована, не иначе. Или они просто были не дураки, в отличие от тех, кому впаривали сказки про телегонию?

В годы так это 1912 – 15 телегоническая ахинея резко сошла на нет. Почему? Народ тогда здорово интересовался успехами естественных наук, а наука пришла к переоткрытию законов забытого Грегора Менделя и родила генетику.


Не осиливших в средней школе основы этой замечательной науки, призываю повесить свои уши на гвоздь внимания, а мозги водрузить на стол понимания.

================

Наследственная информация дискретна, и от родителей к детям передается материальными носителями, именуемыми генами. Ген – это как бы атом или, точнее, квант наследственной информации. Расположены гены в особых внутриклеточных образованиях, именуемых хромосомами. У разных видов живых организмов своё число хромосом: от 2 до 1400. У человека – 46. Вернее, 23 пары. Во всех клетках данного организма хромосомы бывают только парами. Ген – эта та минимальная единица наследственной информации, которая определяет один признак (свойство организма). Один ген – один признак. (Я предельно упрощаю материал.) Совокупность генов данного организма называется генотипом. Совокупность признаков - фенотипом.


Гены существуют в двух вариантах – аллелях. Бывают аллели доминантные, сильные. При их наличии признак проявляется в фенотипе в том виде, что задается данным аллелем. Второй вариант – рецессивный аллель, слабый. В присутстувии доминантного он не проявит себя никак. Но, если в паре хромосом встретятся два рецессивных аллеля, то их действие проявится в фенотипе.


Всё выглядит просто. Но на самом деле гены не только непосредственно определяют признаки. Они еще взаимодействуют между собой: взаимно усиливают и ослабляют действие, включают и выключают, дублируют и блокируют... А организм, как таковой, его фенотип формируется еще и под влиянием факторов внешней среды.


Выше было сказано, что все клетки организма имеют двойной - диплоидный – набор хромосом. Все. Кроме половых. В генетике они именуются гаметами. Гаметы имеют половинный, гаплоидный набор. Следует отметит, что как носители наследственной информации гаметы - яйцеклетки и сперматозоиды – абсолютно равноправны.

При оплодотворении ядра гамет сливаются и образуется зигота – первая клетка будущего организма, несущая полный диплоидный набор хромосом. Из неё потом формируется новый организм. Генотип и фенотип нового организма определяются - в первую очередь – комбинацией доминантных и рецессивных аллелей в ядрах клеток и сложной игрой внутренних и внешних факторов.


Главное: свойства организма задаются в момент оплодотворения сочетанием материнских и отцовских генов из данных гамет, образовавших данную зиготу.

Ничего сверх этого в зачатии не участвует. Следующее зачатие будет результатом других, на тот момент данных, гамет. И ничего более.

=========


Сперматозоид – мужская гамета – это очень «слабая» клетка. Лишенный способности получать энергию извне, имеющий мнинимальный запас внутренних ресурсов, сперматозоид остается живым несколько часов во влагалище женщины и до трех суток в матке и фаллопиевых трубах.

Никаких других переносчиков генов, кроме хромосом в гаплоидных ядрах гамет, в природе не существует


Таким образом, трое суток – максимальный возможный срок присутствия мужской наследственной информации в женском теле.

Что мы имеем , усвоив вышеизложенное?

Что телегония даже в принципе невозможна!

Ни «очень редко», ни часто – никогда и ни при каких обстоятельствах.


У природы просто нет механизма для этого явления. Она невозможна, как ход игрушечных часов с нарисованными стрелками. Когда это выяснилось, телегония вроде бы еще раз и окончательно умерла. Туда ей и дорога.


Но в последние годы это суеверие снова подняло голову. Питательной почвой для этой «реанимации» стало новая научная безграмотность. Удивительная в наше время антинаучная истерия. Стремительный подъем религии и суеверий.

А «реаниматорами» - неонацисты, националисты и прочие борцы за «чистоту крови».

Но это отдельная большая, сложная и крайне неприятная тема.

Показать полностью
460

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах

Для тех, кто в детстве читал научно-популярные книги 1970-х годов по техническим дисциплинам, давно уже настали скучные времена: про бозон Хиггса или особенности горизонта событий заряженной вращающейся чёрной дыры можно было прочитать ещё полвека назад. Сегодня областью, за прогрессом в которой сложно уследить, является биология. И если рунет заполнен материалами по техническим дисциплинам, что традиционно для России, то биология и биоинформатика представлены крайне слабо.


За последние 18 лет стоимость секвенирования человеческого генома упала в сто тысяч раз до $1000. При этом длина генома человека это три миллиарда нуклеотидов, а геном коронавируса SARS-CoV-2 состоит из всего 30 тысяч нуклеотидов. Учитывая дешевизну и актуальность, множество геномов коронавируса уже секвенировано и выложено в открытый доступ.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Геном коронавируса настолько короткий, что его можно открыть как текстовый файл в блокноте, а различия в нуклеотидной последовательности двух разных геномов видны невооружённым взглядом.


Скачать геномы одной кнопкой можно в GenBank'e , там же есть и начальный, референсный геном от декабря 2019 года из китайского Уханя. Геном это последовательность из всего четырёх типов нуклеотидов - А/Г/Т/Ц, то есть аденин, гуанин, тимин, цитозин. Соответственно, кроме минимальной описательной части и кучи букв A/G/T/C там ничего и нет. Пожалуй, это один из тех редчайших случаев, когда сбор данных для анализа занимает меньше времени, чем сам анализ.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Геномы коронавируса. Слева "начальный" геном из китайского Уханя от 2019 года, справа от 24 марта 2020 года, взятый у одного из инфицированных в США. Начало первого гена в геноме выделено синим цветом. Для удобства просмотра последовательность делят на столбцы одной ширины.



Что есть что?


К счастью, уже построена карта генома и известны нуклеотидные последовательности всех генов коронавируса. Например, первый ген кодирует белок orf1a, его первые 21 нуклеотида такие: ATGGAGAGCCTTGTCCCTGGT - как раз найдены и выделены на скриншоте. Зная начальные и конечные участки генов, не говоря уже о генах целиком, несложно разметить геном и понять что есть что в данном экземпляре коронавируса.



"Мусорная" ДНК


Какие-то участки генома не входят ни в один ген - это мусорная ДНК (РНК), которая не несёт наследственной информации и может мутировать (изменяться) как ей вздумается без вреда и пользы для вируса. Мусорной ДНК сформированы промежутки между генами, а также самое начало и конец генома. На картинке выше первые несколько строк как раз представляют из себя мусорную ДНК, и, например, первая строка не совпадает.



S-протеин


Так как геном во всех своих частях по сути одинаковый набор букв А/Г/Т/Ц, то для простоты анализа можно сфокусироваться на участке генома - на каком-нибудь одном гене.

За проникновение вируса в клетку отвечают белки (s-protein), выглядящие как шип на поверхности, в совокупности образующие ту самую "корону", давшую название этому типу вирусов. Именно на эти белки направлены создающиеся сейчас вакцины, которые должны остановить распространение эпидемии.


Если s-протеин мутирует быстро и сильно, то вакцины не будут поспевать за новыми мутациями, как в случае сезонного гриппа, Если медленно, то одна вакцина избавит человечество от проблем надолго.


Мутации гена, отвечающего за кодирование s-протеина мы и рассмотрим.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Схематичное изображение коронавируса. S-протеин отмечен вверху справа



От слов к нуклеотидам


Весь геном коронавируса это около 30'000 "букв". Последовательность нуклеотидов гена s-протеина известна, их всего 3822 штуки. Вот, например, первые пятьдесят:

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAA


Вот последние пятьдесят:

АAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAA


Если, как Микеланджело, в каждом геноме отрезать всё что до этих первых пятидесяти букв и после последних пятидесяти, то останется ген s-протеина. Поместив каждый ген в строку экселя удобно подмечать мутации. Например, на скриншоте ниже у некоторых гонконгских инфицированных на 22-й позиции стоит G вместо обычного T:

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Скриншот с общими данными по геному и начальной частью гена s-протеина. Стрелками отмечены мутации (замены) Т -> G



Мутации


Геном или один ген это просто наследственная информация. По этой информации производится то, что уже в дальнейшем будет функционировать - белок (1 ген -> 1 белок). Мутация в гене это, обычно, и в нашем случае, замена одной "буквы" на другую. Некоторые мутации в гене приводят к изменению белка, некоторые нет. Некоторые слабо изменяют белок, некоторые сильно, что скорее всего приведёт к недееспособности вируса, так как сделанный по сильно мутированному гену белок будет неправильным и не сможет выполнять свои функции. С другой стороны, против изменённого белка может не подействовать вакцина, спроектированная под предыдущую "версию".


Пройтись циклом по всем геномам, найти ген s-протеина и поискать замены относительно начальной версии от 2019 года это несколько десятков строк простого программирования.



Визуализация


Традиционные линейные или столбчатые диаграммы не подходят для отображения 3822 нуклеотидов и их замен. Для наглядности удобнее расположить последовательность нуклеотидов как текст, слева направо, сверху вниз, а наличие мутации и их количество заменить цветом поля:

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Wake up, Neo...


Цветами обозначено количество вариантов для данной "буквы" среди проанализированных геномов. Например, жёлтый цвет означает, что для данного нуклеотида существуют все три возможных варианта мутации и каждый из которых приводит к немного другой белковой молекуле. Если для "буквы" существует только одна мутация, и та безобидная, то цвет - ближайший к начальному фиолетовому.


Анимация по дням:

Мутации, мягко говоря, присутствуют, не одна и не две, и большинство несинонимичные. То есть те, которые изменяют белок "шипа" коронавируса. Но много это или мало в контексте мутации вируса и вакцин?


Исследователи говорят, что коронавирус SARS-CoV-2 мутирует относительно медленно. Например, сезонный грипп мутирует в разы быстрее. То есть можно рассчитывать, что вакцины, которые уже проходят клинические испытания на людях в семи лабоработориях, будут актуальны и эффективны продолжительный период времени. Раз так, ждём вакцину! =)


Источник: http://celado-ai.ru/blog/How-coronavirus-mutates-and-how-bad-is-it

Показать полностью 4 1
205

Первое обнаружение протеинов и ДНК динозавров

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Не успели мы посмеяться, над фейковыми новостями о создании эмбриона Т-рекса из куринного яйца, как в журнале National Science Review с импакт фактором 13.222 вышла научная статья Alida M. Bailleu и соавторов, под названием "Evidence of proteins, chromosomes and chemical markers of DNA in exceptionally preserved dinosaur cartilage" - "Признаки наличия белков, хромосом и биохимических маркеров ДНК в исключительно хорошо сохранившемся хряще динозавра" представляет доказательства сохранности белков и нуклеиновых кислот в образце динозавра Hypacrosaurus stebingeri (на иллюстрации) возрастом около 65 миллионов лет. https://academic.oup.com/nsr/article/doi/10.1093/nsr/nwz206/5762999

Fig 1. Внешний вид образцов динозвра Hypacrosaurus stebingeri и контрольного образца (современного страуса Эму) микроскопическое обнаружение объектов напоминающие хромосомы и делящиеся клетки.

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

А. Общий вид образца Hypacrosaurus(MOR 548) шейного позвонка. B. Микрофотография кальцинированных хрящевых лакун. C-D  структуры напоминающие делящиеся клетки и хромосомы динозавра под большим увеличением. E. контрольный образец шейного позвонка современного страуса Эму. F. Хрящевая ткань контрольного образца. G клетки замершие в процессе деления и хромосомный материал в контрольном образце.

Fig 2. Окрашивание Алкианским синим (маркер хрящевой ткани) срезов образца динозавра и сорвменного страуса.

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Внешний вид образцов A. хрящевой ткани динозавра и B кости динозавра. Окрашивание Алкианским синим хрящевой ткани C выявляет синее окрашивание (типичное для хондроцитов, клеток хрящевой ткани). D. Минимальное окрашивание костной ткани динозавра Алкианским синим. E-H контрольные образцы страуса эму, так же показывают ярко синее окрашивание хрящевой ткани и минимальное костной.

Данный результат показывает что в образцах действительно хрящь динозавра а не какая-то другая ткань.

Fig 3. Обнаружение ДНК в хондроцитах (клетках хряща) динозавра Hypacrosaurus stebingeri

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Клетки хрящевой ткани динозавра (A-B), окрашивание Propidium iodide (С) и DAPI (D) на присутствие ДНК/Нуклеиновых кислот. (E-G) Контрольные образцы страуса Эму.

Fig 4. Обнаружение протеина Chick Collagen II в материале хряща динозавра Hypacrosaurus stebingeri

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

A-D. Иммунофлуоресцентный анализ антителами к протеину Chick Collagen II (зелёный сигнал) в ультратонких срезах материала Hypacrosaurus stebingeri и хряща современного страуса Эму (E-H). Чтобы подтвердить, что это именно коллаген II, авторы обработали образцы динозавра (C-D) и страуса Эму (G-H) коллагеназой II которая специфически разлагает коллаген II и получили ожидаемое снижение интенсивности сигнала. Чтобы подтвердить, что это именно коллаген II, а не какой либо другой протеин с которым антитела связываются неспецифически, авторы окрасили те же образцы антителами к коллагену I который в хрящевой ткани в норме не пресутствует и не получили сигнала. В дополнительных материалах к статье представлена так же контрольное окрашиве без антител к Chick Collagen II чтобы исключить неспецефическое окрашивание образца вторичными антителами с флоуресцентным маркером (зелёным хромофором) которые спецефически связываются с первичными антителами к Chick Collagen II, отсутсвие сигнала в контрольном образце подтвердило, что это действительно Chick Collagen II, а не случайное явление.

После прочтения статьи, из моей личной критики очень хотелось бы увидеть окрашивание Propidium iodide и DAPI образцов на котором видны хромосомы (Fig 1), оба красителя их должны окрашивать. Однако вероятно хромосомы замершие в процессе деления могли подвернуться большей деградации чем упакованные в ядре клетки и сохраниться только внешне без содержания нуклеиновых кислот. В плане внешнего вида окрашенного материала именно так ядра клеток и выглядят. Не могу не отметить, что ядро динозавра выглядит значительно меньше нормального ядра в обычной клетке современных млекопитающих, в соотношении размера ядра к клетке, но поскольку мы имеем дело со столь древним образцом возрастом миллионы лет малый размер может быть связан с деградацией в образце нуклеиновых кислот .


Данные результаты ставят под сомнение опубликованные в 2012 году Morten E. Allentoft и соавторами, предположения о периоде полураспада ДНК порядка 500 лет и принципиальную невозможность выделения и изучения ДНК динозавров. https://royalsocietypublishing.org/doi/full/10.1098/rspb.2012.1745. Разумеется от обнаружения нуклеиновых кислот, до полноценного или хотя бы частичного генома динозавра огромная пропасть. Тем не менее логичный следующий этап это вырезать ядра клеток из образца лазером и попробовать извлечь ДНК для проведения геномного сиквенса и совмещение с референсным геномом птиц, того же страуса Эму. Насколько часто в архивах встречаются образы сохранности приемлемого для выделения белков и нуклиновых кислот и  в каких условиях пребывал образец, что позволили выявить белки и нуклеиновые кислоты требует дополнительного изучения.

Показать полностью 3
845

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить

UPD к посту есть вопросы: #comment_163870237

_____________

Случилось так, что прошлом году я озаботился вопросом своего происхождения и решил сделать расшифровку своего ДНК через сервис MyHeritage.com.


От заказа набора по сбору ДНК до момента его расшифровки прошло около 2 месяцев. В этот срок входит доставка пакета из США - 2 недели, доставка пакета из Москвы в США - 10 дней, 2 недели на расшифровку ДНК в лаборатории и еще 7-10 дней у меня заняло дойти до почты, собрать образец и отправить его обратно. Возможно, у вас это выйдет немного быстрее. Кстати, проблем с отправкой образцов слюны по почте не возникло никаких, вопросов со стороны сотрудников не было.

Важный UPD. На текущий момент (14.03.2020) ни сайт MyHeritage.com, ни сайт 23andme.com не отправляют наборы по сбору ДНК в Россию. Скорее всего, это случилось после обращения депутата Госдумы РФ от Единой России в Генпрокуратуру. https://www.kommersant.ru/doc/4277236, статья от 5.03.2020.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

В итоге, за 74 доллара я получил расшифровку своего ДНК и анализ происхождения. Из полученного анализа я узнал, что я на 55,7% Прибалт, на 35,1% Восточноевропеец и на 2,4% Ашкеназский еврей (таки да). А также, что из 3000 найденных людей с совпадениями по ДНК, 800 человек проживает в США (скорее всего потому, что там делается наибольшее количество тестов).

UPD 2. Полученные данные по происхождению, похоже, сомнительны. Ссылку на отличный разбор алгоритмов, применяемых в ходе подобных тестов предоставил в ходе нашего спора пикабушник @Jockel, за что ему большое спасибо. https://biomolecula.ru/articles/samaia-bolshaia-semia

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

https://www.23andme.com/, кстати, берет за это подобное исследование - 199$.


На этом я тогда и остановился, так как дополнительная расшифровка по здоровью стоила еще баксов 70, а большого смысла я ней не видел.


Но недавно российский конкурент MyHeritage и 23andMe, компания Genotek, запустила акцию, в рамках которой, можно загрузить на их сайт данные расшифровки своего ДНК и получить информацию по нескольким разделам - здоровье, питание и характер по очень вкусной цене - 2495 рублей за раздел, что по нынешним временам составляет ~35$. Это при том, что обычно Genotek гораздо более жадные и за расшифровку каждого раздела берут по 9995 рублей.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост
О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Данные уже расшифрованного ДНК легко сгружаются в формате .csv из вашего личного кабинета MyHeritage, расшифровка на сайте Genotek занимает немногим менее суток

И вуаля, меньше чем за 100$ (с учетом текущих скидок у MyHeritage) вы получаете и анализ происхождения и анализ генетических рисков по 123 заболеваниям.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Примерно такой же анализ на MyHeritage стоит сейчас в районе 60$ и гораздо менее информативен, но более интересен тем, кто хочет проверить себя на наличие наследственных передающихся заболеваний типа муковисцидоза или болезни Канавана.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Данные, как тот или иной вариант гена влияет на здоровье, Genotek берут в том числе с сайта https://www.snpedia.com, это такая Википедия по человеческому геному, с выводами и предположениями по генам, основанными на опубликованных научных работах (зарубежных в основном), там вообще много интересной информации в открытом доступе, для тех, кому интересно.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Но все это меркнет по сравнению с тем, какую бездну информации по вашему ДНК (у меня около 20 тыс записей) выдает сайт https://promethease.com, где в формате удобного кастомизируемого отчета можно увидеть описания различных генов и их вариантов как с сайта https://www.snpedia.com, так и открытые данные из базы 23andme.


Анализ уже расшифрованного ДНК с сайтов 23andme, MyHeritage и тд стоит у них всего 12$.


В отчете можно обнаружить какие-то базовые вещи - вроде цвета кожи и глаз, так и предрасположенности к заболеваниям типа рака или диабета. Также есть и совсем интересные вещи типа гена чувствительности к кислому вкусу, которая нормализуется с возрастом или, что стало для меня неожиданностью - вариант сочетания 5 генов, при котором достигается в 2,5 раза более эффективный сброс веса с помощью диеты с низким содержанием жиров (а не углеводов, как рекомендуют практически все фитнес-тренеры).

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост
О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Рекомендую сразу скачать отчет от https://promethease.com себе на компьютер и запускать его в отдельном браузере, так как может время отклика может сильно увеличиться


Кто хочет тотально погрузиться в тему расшифровки ДНК вот https://isogg.org/wiki/Wiki_Welcome_Page целая база ресурсов по этой области знаний


Для меня это был полезный опыт, я обнаружил несколько рисков, которые буду еще дополнительно проверять - в тч низкая усвояемость железа (в связи с чем пониженный гемоглобин), повышенная чувствительность к кофеину а также информация по правильной диете с низким содержанием жиров.


Все вышеописанное - результат моего личного опыта и ни в коем случае не реклама, скорее полезный контент для интересующихся.


Для ЛЛ.

Расшифровку своего ДНК, анализ происхождения и генетические риски по здоровью можно осуществить примерно за 2 месяца времени и с бюджетом от 80$ через расшифровку ДНК на сайте MyHeritage (59$ сейчас) и дальнейший подробный анализ на сайтах компании Genotek (по 35$ за отчет) (если мало времени и не владеете английским) и https://promethease.com (12$ за отчет, гораздо больше информации и интересных моментов, но только на английском). Так что если вы давно об этом задумывались, но до сих пор не решались - сейчас отличный момент для этого.


Отдельная благодарность за пост Как я плевал в банку, чтобы познать себя камраду @gdemoyaboroda, который разбирал вопросы расшифровки ДНК гораздо более подробно, и где я и обнаружил в том числе информацию по https://promethease.com и по https://isogg.org/


Скрины мои, фотографии набора MyHeritage и схема по определению лучшей диеты и графика упражнений - взяты из интернета.

Итоговый UPD. В ходе дискуссии со специалистами в комментариях выяснилось следующее.


1. Проводимое компаниями типа MyHeritage, 23andMe, Генотек и тд генетическое тестирование затрагивает только 0,1% вашей ДНК (примерно 600 тыс генетических вариантов). Полученные в результате данные научно не достоверны, так как далеко не факт, что эти компании изучают важные участки генома. Практически полная расшифровка ДНК (95%) называется расшифровкой генома (590 миллионов генетических вариантов) и стоит гораздо дороже. Полную расшифровку генома в коммерческих целях не делают еще никому.


2. Полученные данные по вашему происхождению, похоже, сомнительны. Ссылку на отличный разбор алгоритмов, применяемых в ходе подобных тестов предоставил в ходе нашего спора пикабушник @Jockel, за что ему большое спасибо. https://biomolecula.ru/articles/samaia-bolshaia-semia.


3. Все общедоступные тесты, в данном случае и в наше время, пока что еще являются обычной профанацией. Да, они дают некоторое представление о потенциальных группах риска, но только и всего.


4. Исследования на конкретные предрасположенности к заболеваниям и наследственные заболевания пока еще стоят дорого. Примеры

https://www.kdlolymp.kz/pricelist/petropavlovsk

https://genetico.ru/prices?id=124


5. Открытые базы данных генетических вариантов SNPedia и https://promethease.com НЕ ЯВЛЯЮТСЯ достоверным источником информации, правильно соотнести полученные генетические варианты с их интерпретацией не представляется возможным.


6. Более достоверные открытые базы данных для изучения генетических вариантов - это ncbi, ensembl, genecards, geneontology, www.lrg-sequence.org - в них можно смотреть без биологического образования, но с хорошим английским и консультацией грамотного специалиста.


Итоговые выводы: Данные генетические тесты можно использовать только в развлекательно-познавательных целях, если не жалко денег. Для медицински достоверных результатов пока еще нужно идти в клиники и делать исследования на отдельные заболевания и панели. Можно сделать частичную расшифровку генома, но это будет гораздо дороже генетического теста и потом вам все равно придется дополнительно платить за интерпретацию данных в сторонних клиниках.


А пока ждем дальнейшего удешевления секвенирования и развития новых методов ускоренной генетической диагностики.

Показать полностью 8
57

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др

Примесь является доминирующей в формировании моделей генетической изменчивости. А сравнение последовательностей геномов древних и современных людей зафиксировало многочисленные случаи скрещивания, включая поток генов от неандертальцев и денисовцев, а также от ранних современных людей к неандертальцам. Тем не менее, относительно редкие находки и трудности с получением древней ДНК затрудняют анализ вклада древних популяций в генетическое разнообразие людей. Но тут на помощь приходят новые методы, которые позволяют определять древние примеси, и с каждым годом эти методы становятся всё точнее.

В этой статье собраны некоторые самые новые данные из работ этого года. Речь пойдёт как об анатомически современных людях из относительно недавнего прошлого из Западной Африки, так и о неандертальцах, денисовцах и их предках со странным названием - неандерсовцы, которые в свою очередь смешивались с более древней популяцией, вероятно эректусов, заселившей Евразию 1,9 млн лет назад.

Начну с менее далёкого прошлого.

Сразу отмечу, что многие люди, часто делают одну и ту же ошибку, неверно представляя себе климат в прошлом и Африка не исключение. В качестве примера можно привести, новые данные, полученные благодаря анализу фауны возрастом от 10200 до 4650 лет из пещеры Такаркори в пустыне Сахара на территории Ливии. Где были обнаружены останки рыб, таких как цихлиды и сомообразные, а также животных, которых употребляли в пищу обитатели пещеры.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Поэтому представляя регионы Африки стоит делать поправку на разницу в климате в разные периоды, ведь некоторые регионы когда-то были влажными и богатыми как водой, так и жизнью, о чём свидетельствуют находки многочисленных поселений людей и разнообразия фауны.


Древние западноафриканские охотники и собиратели в контексте истории африканского населения


В работе, опубликованной в феврале этого года, авторы приводят данные ДНК всего генома четырех детей возрастом от 8000 до 3000 лет из пещеры Шум Лака в Камеруне, одного из самых ранних известных археологических памятников в пределах вероятной родины языковой группы банту — бенуэ-конголезской семьи. Хотя всего было проанализировано 18 человек, ДНК только 3-х мальчиков от 4 до 15 лет и одной девочки 4-х лет, оказалась пригодной для дальнейших анализов. В любом случае это первые геномы с этой территории.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

У более древних ребят была гаплогруппа мтДНК L0a2a1, довольно распространённая в Африке и гаплогруппы Y-хромосомы В и A00. Гаплогруппа В распространена у современных охотников и собирателей Центральной Африки, а A00, является древнейшей линией, которая появилась от 200 до 300 тыс. лет назад.

Результаты анализов показали, что современные охотники и собиратели не являются потомками популяции, чьи представители захоронены в пещере Шум Лака, как и большинство современных носителей языков банту. Представители Шум Лака генетически ближе к носителям грассфилдской группы бантоидных языков. И они проживали в регионе, как минимум 5 тыс. лет, после чего были заменены разнородными группами людей, чьи потомки и населяют эти территории в настоящее время.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Были определены 3 основных центра разветвления популяций с 4 отдельными линиями, которые проще воспринимать на графике. Стоит отметить, что узловые точки не означают одновременное расхождение и последовательность, а лишь схематически обозначают относительно небольшой интервал времени.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Ключевыми моментами являются:


1. Раннее разделение людей на популяции, связанные с центральноафриканскими охотниками-собирателями около 300-200 тыс. лет назад (черный цвет), на южноафриканских охотников-собирателей около 250-200 тыс. лет назад (красный цвет), на другие популяции современных людей (оранжевый цвет), и на неизвестную популяцию, по которой нет данных (голубой). Линия, связанная с центральноафриканскими охотниками-собирателями в свою очередь делится на восточную и западную, а последняя и ведёт к представителям Шум Лака.


2. В этом узле происходит разделение на базальную западноафриканскую линию (зелёный цвет), на популяцию людей, которые в последствии вышли за пределы Африки (желтый), на восточноафриканских скотоводов-земледельцев (сиреневый), и на популяцию, связанную с обитателем эфиопской пещеры Мота, возрастом 4500 лет. Выделение популяции, связанной со всеми неафриканцами, произошло между 80 и 70 тыс. лет назад. Что согласуется с филогеографией мтДНК-в частности, с выделением гаплогруппы L3, которая, вероятно, возникла в Восточной Африке около 70 000 лет назад. А также согласуется с выделением гаплогруппы Y-хромосомы CT в тот же период. Эти мутации присутствуют во всех современных мужских линиях человека, за исключением A и B-M60.


3. Узел связан с расширением родословной, связанной с носителями языков банту.


В целом результаты подтверждают недавние аргументы генетиков и археологов по поводу того, что происхождение человека в Африке могло включать глубоко расходящиеся, географически разделенные популяции. Но также стоит отметить наличие в районе расхождения с неандертальцами ещё одной неизвестной предковой линии людей.


Выявление и интерпретация явной неандертальской родословной у африканцев


Суть этого исследования заключается в описании новой методики, которая позволяет обнаружить древние примеси в геномах современных людей. Самым интересным было обнаружение 0.3% неандертальского генома у африканцев.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Хотя ранее считалось, что примесь неандертальцев есть только у неафриканских популяций, около 2%. Примечательно, что некоторые из обнаруженных гаплотипов связаны с реакцией на ультрафиолет. Но ведь африканцы не могли встречаться с неандертальцами. Также 94% неандертальской примеси у африканцев присутствует и у людей за пределами Африки. Результаты дополнительных исследований показали, что имела место обратная миграция в Африку, людей уже с неандертальской примесью. Но также, в меньшей степени, была примесь от сапиенсов к неандертальцам до того, как современные люди вышли из Африки. Также новый метод показал, что следов неандертальцев у азиатских популяций больше всего на 8% чем у европейских, хотя ранее считали, что эта разница составляет 20%.

В целом метод довольно интересный, но он работает только в случае с поиском генетического вклада известных древних популяций, чей геном уже секвенирован.

Но в следующей работе, опубликованной, менее чем через 2 недели, после вышеописанной, для определения уже использовался метод, при помощи которого можно идентифицировать сегменты ДНК древнего происхождения без наличия секвенированного образца генома их носителей.


Восстановление сигналов неизвестной древней примеси в африканских популяциях


В этой работе исследователи предоставили дополнительные линии доказательств архаичной примеси в четырех популяциях Западной Африки. Эти популяции представлены народом Ишан из Южной Нигерии, населением Гамбии, народностью менде в Сьерра-Леоне и группой родственных народов йоруба из Нигерии. Анализ показал, что эти популяции получили от 2 до 19% своего генетического происхождения от древней популяции, которая происходит от общей линии до разделения неандертальцев и современных людей.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

А также этот вклад был обнаружен и у европейских популяций, что подтверждает время примеси до выхода анатомически современных людей из Африки. Используя метод, который может идентифицировать сегменты древнего происхождения без необходимости ссылаться на секвенированные древние геномы, авторы построили карты геномного происхождения перечисленных ранее популяций. Их анализ и выявил сегменты неизвестного древнего происхождения с высокой частотой.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Результаты показывают существенный вклад древнего происхождения в формирование генофонда современных западноафриканских популяций. Но на графике примесь от древней популяции была перед выходом людей из Африки.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Одна из интерпретаций недавнего времени примеси, которую документируют исследователи, заключается в том, что архаичные формы сохранялись в Африке до сравнительно недавнего времени. С другой стороны, древняя популяция могла ранее внести генетический вклад в современную человеческую популяцию, которая затем скрещивалась с предками популяций проанализированных в этом исследовании. Хотя эти модели не являются взаимоисключающими, и вполне вероятно, что история африканцев включает генетические вклады от множества отличающихся популяций, о чем свидетельствует большой эффективный размер популяции, которая генетически связана с архаичной. В то время как анатомически современные люди появляются в ископаемой летописи около 200 тыс. лет назад, относительно молодые окаменелости с сочетанием архаичных и современных анатомических особенностей были найдены в Африке к югу от Сахары и на Ближнем Востоке.

Примерами таких окаменелостей являются череп из Иво Элеру, на юго-западе Нигерии, возрастом 13 тыс. лет и человеческие останки из Ишанго в современной Демократической Республике Конго, дотированные около 20 тыс. лет, которые не вписываются в рамки изменчивости современного человека. А это может указывать на то, что ещё относительно недавно по Африке бродили люди, отличающиеся от современных и вносили свой вклад в геномное разнообразие африканцев, демонстрируя сложную историю взаимодействия современных и архаичных людей в Африке. Неафриканские популяции также демонстрируют аналогичные смеси, предполагая, что компонент архаического происхождения присутствовал до разделения африканского и неафриканского населения. Детальное понимание архаичной генетической примеси и ее роли в адаптации к разнообразным условиям окружающей среды потребует анализа современных и древних геномов по всему географическому диапазону Африки.


Предки неандертальцев и денисовцев скрещивались с дальними родственниками людей


Авторы этой работы "копнули" ещё глубже чем предыдущие, на сотни тысяч лет назад, когда представители рода людей с более крупным мозгом появляются в окаменелостях Европы вместе с ашельскими каменными орудиями. Существуют разногласия по поводу того, как следует интерпретировать этих первых европейцев. Некоторые видят в них общих предков современных людей и неандертальцев, другие - в качестве эволюционного тупика, которых позже заменили выходцы из Африки, а третьи - в качестве первых представителей линии неандертальцев. Новые оценки наиболее соответствуют последним из этих взглядов. Они подразумевают, что 600 тыс. лет назад неандертальцы были уже отдельной линией, отделенной не только от линии современных людей, но и от денисовцев. Эти результаты разрешают противоречия с окаменелостями гейдельбергского человека из Сима-де-лос-Уэсос, которые вначале были датированы как минимум в 350 тыс. лет. Генетические данные показали, что они были представителями более ранней популяции предков до неандертальцев и, следовательно, после разделения неандертальцев и денисовцев. Однако генетические данные указывали на то, что этот раскол произошел около 381 тыс. лет назад. Это было трудно согласовать с предполагаемым возрастом окаменелостей из Сима-де-лос-Уэсос, но позже нестыковка увеличилась, ведь усовершенствованные методы датирования показали возраст окаменелостей, около 600 тыс. лет и намного старше молекулярной даты разделения денисовцев и неандертальцев. Это несоответствие частично объясняется различными калибровками скорости мутаций. Исследователи кафедры антропологии, университета Юты, также отмечают, что новые результаты по численности неандертальцев отличаются от тех, которые они опубликовали в 2017 году и которые были подвергнуты критике их коллег. Кстати это хороший пример признания учёными своих ошибок. По новым оценкам авторов исследования, этот конфликт разрешается, переносом даты разделения далеко за пределы возраста окаменелостей из Сима-де-лос-Уэсос, используя геномы с более высоким покрытием - неандертальца из пещеры Виндия в современной Хорватии, а также алтайских денисовца и неандертальца. При этом неандертальцы, которые поделились своей ДНК с современными европейцами, генетически были больше похожи на неандертальца из пещеры Виндия, чем на неандертальца из Денисовой пещеры. Здесь стоит отметить, что на Алтае жили разные неандертальцы. Относительно недалеко от Денисовой пещеры, расположена Чагырская пещера, где жили неандертальцы из второй волны заселения, которые отличались от своих более древних соседей, как по каменной индустрии, так и генетически.

Сложная популяционная история и модели примеси в роду людей. Неандертальцы, денисовцы, эректусы и др Наука, Антропогенез, Эволюция, Генетика, Происхождение человека, Видео, Длиннопост, ДНК, Гифка

Новая реконструкция включает в себя три волны миграции рода людей из Африки в Евразию:


1. Миграция ранних Homo или "супердревней" популяции около 1,9 млн. лет назад. Что совпадает с датировкой дманисских гоминидов.


2. Миграция около 700 тыс. лет назад предковой линии неандертальцев и денисовцев до их разделения. Именно эту популяцию исследователи для простоты назвали, совместив два слова - неандертальцы и денисовцы. Для нас это что-то на подобие "неандерсовцев".


3. Миграция современных людей около 50 тыс. лет назад.


При этом, результаты показывают, что "неандерсовцы" скрещивались с представителями "супердревней" популяции в начале среднего плейстоцена, вскоре после их прихода в Евразию. Скорее всего это были евразийские эректусы. Это самая ранняя известная смесь между популяциями из рода людей. Кроме того, эти две популяции были более отдаленно связаны друг с другом, чем другие популяции, из известных на данный момент, которые скрещивались между собой. Они были разделены по происхождению на 1,2 млн лет. Позже, когда представители "супердревней" популяции людей обменивались генами с денисовцами, эти две популяции были еще более разделены во времени. Для сравнения, неандертальцы и денисовцы, которые скрещивались с современными людьми, были отдалены друг от друга менее чем на 700 тыс. лет. Вполне вероятно, что "супердревние" люди произошли от первоначальной популяции людей в Евразии, чья расчётная численность составляла от 20 до 50 тысяч человек. Такой размер указывает на то, что эта популяция включала по меньшей мере две глубоко разделенные подгруппы, одна из которых смешана с неандерсовцами, а другая - с денисовцами. Исследователи предполагают, что около 700 тыс. лет назад неандерсовцы вышли из Африки в Евразию, испытали эффект бутылочного горлышка или сокращение генофонда, скрещивались с древними популяциями людей Евразии, которые уже там жили более миллиона лет, а потом в значительной степени заменили их в свою очередь разделившись на восточные и западные субпопуляции - денисовцев и неандертальцев. Похожие события произошли 50 тыс. лет назад, когда анатомически современные люди вышли из Африки и сменили неандертальцев и денисовцев.

Эта работа также примечательна тем, что демонстрирует, сколько нужно времени, чтобы изолированные друг от друга популяции людей всё ещё могли скрещиваться. Получается, что как минимум 1,2 млн лет в тех же условиях.

В завершении хочу акцентировать внимание на том, что все упомянутые работы были опубликованы с небольшим перерывом в этом году. Поэтому представьте, как много информации появляется в различных направлениях науки каждый месяц.

Источники:
1. Lipson, M., Ribot, I., Mallick, S. et al. Ancient West African foragers in the context of African population history. Nature 577, 665–670 (2020). https://doi.org/10.1038/s41586-020-1929-1 Identifying and Interpreting Apparent Neanderthal Ancestry in African Individuals
2. Lu Chen, Aaron B. Wolf, Wenqing Fu, Liming Li, Joshua M. Akey, Show footnotes Published:January 30, 2020 https://doi.org/10.1016/j.cell.2020.01.012
3. Recovering signals of ghost archaic introgression in African populations Arun Durvasula and Sriram Sankararaman https://doi.org/10.1126/sciadv.aax5097
4. Neanderthal-Denisovan ancestors interbred with a distantly related hominin Alan R. Rogers*, Nathan S. Harris and Alan A. Achenbach https://doi.org/10.1126/sciadv.aay5483 5. Van Neer W, Alhaique F, Wouters W, Dierickx K, Gala M, Goffette Q, et al. (2020) Aquatic fauna from the Takarkori rock shelter reveals the Holocene central Saharan climate and palaeohydrography. PLoS ONE 15(2): e0228588. https://doi.org/10.1371/journal.pone.0228588

Показать полностью 8
195

Интересное о ДНК

Можно ли отличить близнецов по ДНК? А составить портрет преступника? Найти дальних родственников?

Интересное о ДНК Биология, Генетика, Биотехнологии, ДНК, Наука, Длиннопост, Фонд эволюция, Гены

Оборудование для чтения генома становится все изящней и совершенней. Например, маленькое устройство, подключенное к ноутбуку на фотографии – это секвенатор третьего поколения, нанопоровый MinION, способный прочитать до 2 млн нуклеотидов за один проход. А как это можно применить, например, в криминалистике?


Однояйцевые близнецы развиваются из одной клетки, разделенной пополам, и изначальный набор генов у них был одинаков. Но в ДНК происходят мутации еще с самых первых дней зародыша, и продолжаются всю жизнь. Полногеномное сканирование может выявить отличия всего в несколько нуклеотидов! Так можно выявить преступника. Правда, в случае установления отцовства это не поможет)


Чтобы иметь возможность составить портрет по ДНК, нужно собрать огромные массивы данных. Геном не сканируется полностью в каждом случае, лишь анализируются характерные кусочки и сопоставляются с внешними признаками. Есть сложность: для каждой популяции надо создавать свою базу. В итоге можно определить пол, цвет кожи, предположить рост и склонность к полноте, примерный возраст и генетические заболевания. Для черт лица пока что есть лишь вероятность в процентах. Но какие-то признаки могут быть «точно не»: не карие глаза и не вьющиеся волосы, к примеру. В США с помощью этой технологии уже удавалось найти преступников. В странах СНГ с 2017г. тоже работает аналогичный проект «ДНК-идентификация».


Генетика помогает не только криминалистике, но и истории. Y-хромосома, в отличие от других, почти неизменная передается по мужской линии. Исключение – совсем небольшие участки, где происходит обмен, и точечные мутации, которые накапливаются из поколения в поколение. С ее помощью можно отследить родственные связи аж на несколько тысячелетий! А общие характерные признаки (гаплотип) могут рассказать, какой группе принадлежит эта хромосома – европейцы, африканцы, азиаты… Правда, если чей-то забытый прапрапрадедушка приехал издалека, его потомков будет ждать сюрприз) Но в областях, где народ жил обособленно на протяжении долгого времени, может сформироваться свой уникальный гаплотип. Это помогло в 2011 г. узнать имя террориста-смертника, взорвавшего бомбу в Домодедово.


А что у нас по женской линии? А по ней есть митохондрии – энергетические станции клетки, имеющие свой небольшой геном (около 16 тысяч нуклеотидов, в отличие от ядерного генома, в котором около 3 млрд). В большинстве случаев они все передаются от матери вместе с яйцеклеткой. Таким образом, родственные связи по женской линии тоже можно отследить.


Данная статья представляет собой краткий обзор книги Е.В. Клещенко "ДНК и ее человек", 2019г. Уточнение по наследованию митохондий: в 2018 г. был установлен факт возможности их наследования от обоих родителей в редких случаях: https://www.pnas.org/content/115/51/13039

Показать полностью
77

Томас Кран о секвенировании генома

Томас Кран, генетик, руководитель лаборатории YSEQ участвовал в организованной ИОГен РАН международной конференции "Столетие популяционной генетики человека" в Москве и любезно согласился дать нам интервью. Мы спросили, что такое гаплотипы, как их определяют и зачем это нужно.

Благодарим за предоставленное помещение библиотеку "Научка".


Оператор: Алла Пашкова.

Интервьюер: Андрей Шкиперов.

Перевод: Олег Науменко, Андрей Шкиперов.

Озвучка: Андрей Шкиперов, Павел Камушкин.

Дизайн: Алла Пашкова.

Монтаж: Александр Афанасьев.

Интервьюер: Здравствуйте, Томас. Рады возможности пообщаться с вами здесь, в Москве. Первый вопрос — мы называем большие группы людей, которые имели очень давнего общего предка, гаплогруппами. Они так называются, потому что их гаплотипы очень похожи…


Томас Кран: Да, на самом деле они не только похожи, но и в определенной степени идентичны. Раньше мы использовали STR-маркеры, краткие тандемные повторы, но у них очень высокая скорость мутаций. Поэтому результаты получались немного расплывчатыми — мутации были и прямыми, и возвратными тоже. Но сейчас мы все больше и больше погружаемся в SNP-филогению (SNP – single nucleotide polymorphism, однонуклеотидные замены, также в русскоязычной среде часто используется жаргонизм “снип” – прим. ред.) и можем даже говорить о гаплотипах, состоящих из снипов — и вот они не только похожи, но и в значительной степени идентичны для разных индивидов в одной группе.


Интервьюер: Вы сейчас затронули два вопроса, так как мой второй вопрос касался STR-маркеров — почему они слабы для наших целей? Тогда следующий вопрос — почему именно STR-гаплотипы раньше были главной характеристикой хромосомы?


Томас Кран: Раньше нам были доступны только STR-маркеры, потому что эта технология гораздо проще для тестирования, и вы всегда проверяете одни и те же маркеры. Но сейчас появились новые способы секвенирования и значительно более совершенные процессы для тестирования SNP. Мы приближаемся к точке, когда сможем проводить тесты SNP, снипов в Y-хромосоме, с той же точностью за ту же цену, даже скорее с гораздо большей точностью.


Интервьюер: Спасибо. При генотипировании в своей лаборатории вы используете снипы, панель маркеров SNP. Но вы не используете олигонуклеотидные полиморфизмы — когда несколько снипов идут подряд. Также вы обычно не используете вставки и делеции для своих тестов. Почему?


Томас Кран: Не совсем так. Прежде всего, вставки и делеции могут быть очень хорошими, надежными и стабильными, если есть только два-три нуклеотида, которые удаляются или вставляются, и нигде в этой последовательности нет повторов. Однако если один и тот же кусок повторяется, скажем, восемь раз или больше, то это становится проблемой. Тогда у нас есть по сути настоящий участок STR, который может мутировать взад-вперёд — и таких участков мы стараемся избегать ради стабильности филогенетического дерева. Поэтому мы пытаемся использовать повторы вплоть до, может быть, четырёхкратных, а если больше — считаем, что дерево становится слишком нестабильным. Но в целом вставки и делеции НЕ ненадежны или плохи, их просто сложнее протестировать используемыми технологиями, и обычно для их оценки требуется человек, работающий вручную, потому что их можно описать совершенно по-разному. И очень трудно найти для этого устойчиво качественный метод.


Интервьюер: Спасибо. И когда вы читаете снип, как вы находите точное место во всей ядерной ДНК, где находится этот снип? То есть, речь идет о технологии: как вы читаете конкретный участок молекулы?


Томас Кран: Сейчас это очень распространённая процедура — мы применяем методы NGS (секвенирование нового поколения). По сути NGS — это нарезка всей ДНК на короткие фрагменты и их секвенирование, а затем сборка паззла на референсной последовательности с помощью компьютера. Это то, что мы обычно делаем. И если мы видим разницу с референсной последовательностью, то как правило это означает, что есть какая-то вариация. Конечно, нам нужно рассортировать и каталогизировать все эти вариации и посмотреть, какие из них являются общими для нескольких людей, а какие — просто индивидуальная мутация у конкретного человека. Сейчас мы занимаемся доработкой филогенетических деревьев до мельчайших деталей, поэтому индивидуальные мутации очень ценны для человека, который сдал новый тест. Мы пытаемся определить для него новые маркеры, помещаем их в каталог, чтобы другие люди могли сравнить себя с ним. И когда два человека находят у себя одну и ту же мутацию, это говорит о том, что они — родственники, и мы находим новый узел дерева — это то, что нам нужно.

Томас Кран о секвенировании генома Генетика, Популяционная генетика, Секвенирование, ДНК, Генеалогия, Видео, Длиннопост

Интервьюер: Но если кто-то просит всего один SNP, вы делаете праймеры или…?


Томас Кран: Да, обычно у нас есть результат анализа всего генома или NGS-секвенирования, в котором люди находят новый маркер. Но проводить исследование всего генома для каждого члена большой семьи — это очень дорого. Поэтому мы думали о том, как всё удешевить. Если вы уже знаете мутации, характерные для вашей семейной ветви, нет необходимости исследовать Y-хромосому целиком. Вы просто смотрите на один маркер, и он уже есть в нашей лаборатории. Часть процесса — это проверка маркера: надёжен ли он, можем ли мы сделать праймеры? И если можем, мы ставим маркер в очередь, всё занимает буквально несколько недель — и вот у нас есть праймеры, которые мы сразу же можем включать в тесты.


Интервьюер: Тогда вопрос — как разрабатываются праймеры? Если можно, пару слов об этом. Какие с этим бывают трудности?


Томас Кран: Мы уже разработали около сорока тысяч пар праймеров. Обычно мы берем участок из референсного генома вокруг снипа, плюс-минус, например, пятьсот пар оснований, и пытаемся найти идентичные области в другом месте генома. Например, мы просто... удаляем Y-хромосому из референсной последовательности, что делает ее женской референсной последовательностью, а затем сопоставляем нужный кусок ДНК с остальной частью генома, и мы очень часто видим: о, он совпадает с X-хромосомой, он идентичен на — может быть 90%, может 95, иногда бывает даже 100% — вообще различий нет. И чем выше сходство, тем выше вероятность того, что на этом участке была рекомбинация хромосом друг с другом, что плохо для филогенетического дерева, потому что тогда у нас будут обратные и параллельные мутации. Мы стараемся избегать такого. И у нас есть более или менее случайная, но довольно чёткая грань, где это действительно становится проблематичным — это 95%. Конечно, можно возразить, что это число взято с потолка, но таков наш опыт работы со многими, очень многими созданными нами праймерами, и мы пришли к выводу, что слишком обидно разрабатывать пограничные праймеры, платить за них деньги и видеть, что они не работают. Вот так мы пришли к этому числу.


Интервьюер: Что касается сложностей, также существуют палиндромные участки. Может быть, какие-то ещё есть трудности? Расскажите об этом.


Томас Кран: Ну, я только что упомянул, что мы сопоставляем с женской эталонной последовательностью, но, конечно, есть повторяющиеся единицы, участки и на самой Y-хромосоме. Y-хромосома имеет самую большую палиндромную последовательность, и у нас есть, например, палиндром P1 — 1,6 миллиона оснований — которые, я бы сказал, более чем на 99% идентичны с обеих сторон. Это по сути последовательность, которая идёт вперед, разворачивается и возвращается с обратной комплементарной последовательностью.

Томас Кран о секвенировании генома Генетика, Популяционная генетика, Секвенирование, ДНК, Генеалогия, Видео, Длиннопост

Таким образом, вы можете себе представить, что практически идентичные участки некоторых палиндромов также рекомбинированы друг с другом, мы видели это и в прошлом с маркерами STR. Так что да, эти участки, конечно, являются проблемой для филогении. Но они хороши для выживания Y-хромосомы, потому что она может сама себя восстановить, и эти участки следуют очень сложной логике. Но самое интересное, что некоторые гаплогруппы — как J1 — имеют огромную делецию в этой палиндромной области, поэтому в их большом палиндроме не хватает одного плеча. Так что для них мы можем использовать эту последовательность, так как она не рекомбинирована, а уникальна. Таким образом, последовательности для некоторых гаплогрупп на Y-хромосоме могут быть использованы для филогенетического дерева, в то время как в других гаплогруппах этот же участок не пригоден для таких целей.


Интервьюер: Интересная информация. Вы сказали, что палиндромные участки могут быть огромными, но целая хромосома во много раз больше, поэтому вы получаете огромное количество данных. Как вы управляетесь с ними? Какие инструменты вы используете для работы с этими данными?


Томас Кран: Конечно, секвенирование нового поколения даёт массу данных. Интересно, что это только один процент генома, Y-хромосома. Так что, по сути, мы стреляем из пушки по воробьям. В любом случае, это все еще двадцать миллионов оснований, на которые мы смотрим. И эти двадцать миллионов оснований... Мы по существу из них извлекаем различия с референсной последовательностью, что сводит информационное содержимое только к важным вещам — по сути, к снипам, которые мы наблюдаем. Инструменты, которые мы используем — это BWA-MEM для мэппинга, стандартная программа для мэппинга, поэтому у нас уже есть только те участки, которые можно наложить на Y-хромосому. Далее, мы используем samtools, vcftools для извлечения мутаций, необработанных мутаций. Затем нам нужно сравнить их с базой известных SNP — по сути, это база данных, которую мы публикуем под названием Ybrowse. И из этой базы данных мы уже знаем, какие из них находятся в предковом (отрицательном) или мутировавшем (положительном) статусе. И по этой информации мы можем точно определить, где именно на дереве находится человек. И теперь любая другая найденная в ДНК мутация, которой нет в каталоге, является потенциально новой. И да, это собственно то, что мы делаем: просто регистрируем её в нашем каталоге, в нашей огромной базе данных как новую мутацию. И мы надеемся, что когда-нибудь кто-нибудь другой придет и будет иметь те же мутации, тогда мы сможем развить Y-хромосомное древо, улучшить его разрешение.


Интервьюер: Тестирование с помощью методов NGS стало существенным шагом в уменьшении цены на полногеномные исследования. А какие ещё перспективы удешевления существуют? Или, может, быть, какие-то ещё варианты, как сделать исследование всего генома более доступным для большого числа людей?


Томас Кран: Существует известное предположение, что секвенирование становится дешевле, дешевле и дешевле. Так что люди даже не определились, имеет ли смысл оставить информацию в пробирках с извлечённой ДНК, и секвенировать позже, потому что так будет дешевле, или даже повторное секвенирование станет дешевле, чем дисковое пространство для хранения результатов. Хотя я думаю, что нам ещё далеко до этого. Так что да, секвенирование становится дешевле, появляются новые технологии. Теперь у нас есть секвенирование нового поколения методом синтеза, где доминирует компания Illumina. Есть несколько других компаний, занимающихся, по сути, очень похожим бизнесом, не так хорошо известных — как, например, Ion Torrent Technology, которые измеряют результаты секвенирования по изменению pH. Китайцы придумали протокол секвенирования методом синтеза «nano-balls», ДНК-наношарики.

Томас Кран о секвенировании генома Генетика, Популяционная генетика, Секвенирование, ДНК, Генеалогия, Видео, Длиннопост

Далее, есть очень интересная технология «nanopore» — ДНК просто проталкивают через мельчайшую пору, и пока ДНК проходит через это маленькое отверстие, сопротивление меняется в зависимости от основания... Аденин, гуанин, цитозин и тимин — все они имеют различные сопротивления. И от той маленькой закорючки, которую мы получаем, мы можем с помощью значительных вычислительных мощностей рассчитать последовательность, которая прошла через эту пору. Так что это технология, где вы можете по сути.... Со всеми остальными технологиями вам понадобятся некоторые сложные измерения флюорисценции или pH, а с нанопорами вы непосредственно секвенируете ДНК.

Томас Кран о секвенировании генома Генетика, Популяционная генетика, Секвенирование, ДНК, Генеалогия, Видео, Длиннопост

Интервьюер: Мы слышали такие слова, как секвенирование и генотипирование. В чем разница между генотипированием и секвенированием?


Томас Кран: Ну, генотипирование заключается в том, что вы специально смотрите на мутации, позиции которых уже известны, тогда как при секвенировании вы проходите через всю последовательность ДНК, не зная, есть ли мутация или нет. И вы можете найти уже известные мутации, но вы также можете найти новые мутации.


Интервьюер: Вторая часть беседы — о популяциях и так далее. В каких областях знаний мы можем использовать данные о ДНК, применять результаты нашей работы с геномами? Допустим, медицина, где-то ещё?


Томас Кран: Где ещё можем использовать? Как я уже говорил, медицинская и популяционная генетика, безусловно, являются одними из основных целей этой технологии. Но, допустим, вы можете использовать ДНК для хранения цифровых данных. Вы можете синтезировать ДНК сегодня и использовать её в качестве жёсткого диска. Вы можете заглянуть в окружающий мир, в микробиологию, и это очень интересно. При полногеномном секвенировании всегда присутствует около пяти процентов последовательностей из бактерий, из тех видов микроорганизмов, которые мы носим с собой — это часть нас на самом деле. Мы состоим не только из ядерной ДНК и митохондрий, но и из микробиома, который, конечно же, различен во рту и в других частях организма. Это ещё один аспект. Так что да, ДНК — это про биологию в целом.


Интервьюер: Какие обычно цели у людей, делающих тесты в вашей лаборатории?


Томас Кран: Я думаю, YSEQ немного отличается от привычных компаний потребительской генетики. Мы находимся более или менее в той сфере, которая поддерживает «гражданскую науку». Клиенты, которые приходят к нам, как правило, уже тестировались в одной из крупных американских компаний, или имеют некоторые результаты STR, или начинают с уровня, где они пытаются уточнить свои находки. Хорошо, что каждый может сам решить, каким путём он хочет идти и какой из них наиболее эффективен для ответа на его вопросы. У нас, конечно, много генеалогов, которые, по сути, хотят создать родословную своих близких и родственников. Они хотят получить подтверждение своих записей, или даже выйти за рамки того, что даёт им бумажная генеалогия. Также к нам приходят просто частные исследователи, которые очень интересуются гаплогруппами, к которым они принадлежат. Они пытаются определить происхождение своей гаплогруппы. И что самое интересное, многие наши клиенты фактически выходят за рамки того, что написано в научных публикациях. Они с энтузиазмом читают все публикации, принимают то, что делается в науке, но стараются внести свой вклад в это дело, и действительно находят очень интересные вещи. Без генеалогов гаплогруппа А00 не была бы открыта. Просто один чернокожий американец хотел узнать о своём происхождении. Мы не смогли ничего сказать и провели дополнительные исследования. Много таких «гражданских учёных» внесли свой вклад и даже потратили деньги на эти исследования — потому что это приносит определённое удовлетворение: о, то, что мы делаем, влияет ещё и на науку вообще.


Интервьюер: Может быть, некоторые люди задают вопросы, выходящие за рамки ДНК, вопросы, на которые невозможно ответить с помощью ДНК-тестов, но они думают, что смогут найти ответы?


Томас Кран: К сожалению, граница между тайнами и реальностью очень тонкая. Так что, конечно, иногда желаемое принимается за действительное, и иногда люди очень разочаровываются, когда результаты ДНК не подтверждают их ожидания или даже идут вразрез с их ожиданиями. Конечно, иногда результаты разочаровывают, но, знаете, я раньше проводил тесты на отцовство, и всегда очень трудно сказать отцу: "Это не ваш ребёнок". В итоге это практически та же самая ситуация, но мы должны быть честными, это продвигает нас вперёд. А иногда разочарование в дальнейшем оборачивается очень захватывающим открытием. Например, мы поехали на Камчатку и взяли образцы. И мы надеялись найти связи с американскими индейцами, поэтому просмотрели все образцы. И у нас было только два образца, которые могли иметь какое-то отношение к Америке. Но оказалось, что они были, по существу, в два раза дальше, за два шага до того, что было известно как типичная американская ветвь гаплогруппы Q. Мы только руками развели: ну, очень жаль — мы что-то нашли, но это нам почти ничего не говорит. В итоге всё же это была интересная ветвь, и мы секвенировали весь геном. И обнаружили много новых снипов и решили: хорошо, отложим эту находку в сторону. А потом, всего два месяца назад, мы нашли в Америке древний образец ДНК, который был секвенирован не нами, а другой группой — и они также испытали некоторое разочарование, они тоже сказали: о, наш образец не соответствует ни одной из известных нам американских филогенетических клад. Так что они были разочарованы, я был разочарован. Но потом мы сравнили эти два гаплотипа, эти два набора снипов, и вдруг поняли: о, двадцать из сорока найденных нами и ими мутаций — совпадают. Таким образом, это говорит нам, что была другая линия, которая пришла в Америку, а затем в Америке просто исчезла. Так что это очень интересная находка, которая является результатом двух разочарований.


Интервьюер: А какие ещё линии вы нашли на Камчатке? Может быть, какие-то интересные этнические группы или что-то в этом роде?


Томас Кран: Камчатка — это пример практически неизученной местности. Я не знаю... Многие из русских даже не были там. Так что это был очень интересный опыт. Я бы сказал, что каждый образец, который мы тестировали, буквально привёл нас на неизведанную землю. Это были редкие гаплотипы, которых мы никогда раньше не видели, хотя мы могли их определить и сказать: "о! они из той ветви", но на этих ветвях раньше было максимум по одному образцу. Нужно проделать ещё много работы, чтобы по-настоящему понять связи с южнокитайскими линиями гаплогруппы С и так далее… гаплогруппы О. И мы даже нашли на Камчатке человека из гаплогруппы D, который, вероятно, имеет некоторые связи с Японскими островами. Так что предстоит узнать много нового, того, что мы пока не знаем.


Интервьюер: Возможно ли что однажды все люди будут секвенированы?


Томас Кран: Я думаю, это просто здравый смысл. То есть, когда-то мы ездили на лошадях и представить себе не могли, что повсюду будут машины. И тут точно так же. Я думаю, что в определённый момент каждый человек на этой планете будет секвенирован — например, чтобы с медицинской точки зрения просто убедиться, что заранее известно, с какими рисками вы столкнётесь. И, возможно, в будущем мы сможем принять эффективные меры, чтобы избежать хотя бы некоторых из этих опасностей. Может быть, это будут простые методы, может быть, будут прекрасные фантастические методы, которые мы откроем в будущем. Я всегда говорю, что лучше знать своего врага, чем быть неподготовленным. Так что, при действительно дешёвом секвенировании — конечно. Я думаю, рано или поздно так и будет. И в этом есть смысл. Конечно, когда секвенированы будут все, появится много ответственности, вопросов конфиденциальности, и их необходимо будет решать. Но их нельзя решить запретом на секвенирование вашей собственной ДНК, или запретом на секвенирование вашей ДНК для всех остальных. Так не работает. Поэтому нам нужно принять законы и найти приемлемые для общества правила. Это не та проблема, которую мы можем просто отложить в сторону, мы должны признать её и искать решения.


Интервьюер: Вы говорили о человеке из гаплогруппы A00, но вы и сами бывали в Африке и тестировали там людей. Может быть, вы можете рассказать об этой работе?


Томас Кран: Да, обычно я использую любую возможность, чтобы попасть в другие страны и связать это с чем-то полезным, что может помочь нам лучше понять филогенез Y-хромосомы. «Моё хобби — это моя работа», да, но мне это интересно, я не собираюсь проводить отпуск на круизном лайнере, где всё вокруг происходит ради меня. Я хочу действовать, быть активным. Так, я ездил в Камерун, Судан, на Камчатку. Мы побывали в Мексике и собрали образцы — в основном, у людей, которые действительно хотели внести свой вклад в исследования. И, конечно, мы платим за их тестирование, они получают результаты. Это своего рода диалог. И у нас есть очень хорошие друзья во всех этих странах, хорошие отношения. Это здорово, и это пополняет копилку наших знаний.


Интервьюер: Как вы думаете, какие этнические группы или гаплогруппы будет интереснее всего исследовать, изучать в дальнейшем?


Томас Кран: Вообще, каждая гаплогруппа интересна, особенно для тех, кто принадлежит к этой гаплогруппе. Кроме того, есть вопросы, из-за которых у нас в дереве огромные пробелы. Подумайте: у гаплогруппы D и E есть общий предок. D чаще всего встречается в Японии, E чаще всего встречается в Африке. Так как же они связаны друг с другом на самом деле? Что же произошло в эти тёмные века, около восьмидесяти тысяч лет назад, что случилось в то время, из-за чего люди перемещались на громадные расстояния? С одной стороны, они заселили большой остров, с другой — огромный континент. Как всё это связано? Конечно, туда трудно попасть, но нужно ехать туда, где всё случилось. Естественно, мы не знаем, где именно жил общий предок: в России, в Казахстане, в Индии — где-то в этом регионе. Может быть, в Гималаях. Так что именно туда нам нужно ехать и собирать больше образцов, потому что зачастую это бедные страны, люди не могут себе позволить ДНК-тестирование, у них другие проблемы: они просто выживают, а не тратят свои деньги на ДНК-тесты.


Интервьюер: Кстати, вчера мы узнали, что в Китае нашли образец DE*.


Томас Кран: На самом деле Китай — это очень интересно. Это полное изменение перспектив геномики. Так, я посетил конференцию по судебному ДНК-тестированию в Китае, они начали с нуля и обогнали все другие страны. Китайцы уже протестировали больше образцов ДНК, чем все другие страны. Конечно, данные не являются общедоступными, и они только начинают. Работы свидетельствуют, что они много секвенировали для медицинских целей. И некоторые данные сейчас всё-таки становятся достоянием общественности, что, я уверен, коренным образом изменит наше понимание Центральной Азии.


Интервьюер: Также сложилась интересная ситуация с гаплогруппой Q в Норвегии...


Томас Кран: Да, это ещё одна интересная находка, к которой мы приложили некоторые усилия. Мы на самом деле ездили в Норвегию и взяли там образцы, но, к сожалению... по-моему, мы нашли только один новый образец гаплогруппы Q, и он рассказывает нам историю, которую мы уже слышали. Но о чём эта история? Обычно гаплогруппа Q встречается в Америке, особенно та часть дерева, в которой доминируют последовательности американских индейцев. Как из Северной, так и из Южной Америки. Но эта конкретная ветвь является более поздней, чем переход через Берингов сухопутный мост. Но! Её больше нет на американском континенте, зато есть в Норвегии... Если посмотреть на людей группы Q-L804 — в Земле фьордов, в Скандинавии или на Британских островах (это всё регионы, где такие группы встречаются), у всех этих людей был общий предок. Но этот предок восходит, вероятно, к трём-четырём тысячам лет назад — в таком промежутке. И это большой вопрос. Если вы сперва подумаете: «О, да, конечно, это викинги отправились на Ньюфаундленд, взяли там людей — мужчин — и привезли их в Европу», то так не объяснить эти четыре тысячи лет, такое случалось где-то тысячу лет назад. Так что мы рассматриваем некоторые несоответствия в этой модели. Существует мнение, что, может быть, в это время Q пришла из Центральной Азии. Но тоже нет следов! Нигде в России, нигде в Финляндии нет промежуточных гаплотипов — только в Норвегии и несколько в Швеции. Но шведские, на самом деле, из более поздней ветви. В любом случае нам нужно придумать более сложные модели. Если мы будем следовать тезису, что Q попала из Америки в Норвегию с викингами, то мы получим вымирание этой группы в Америке, потому что больше мы её там не находим. Это не лишено смысла, потому что европейцы принесли болезни и многие линии — особенно в восточной части континента — вымерли. Однако в таком случае, мы можем считать, что в Норвегию тогда прибыли не меньше чем двое-трое разных мужчин из похожих, но не идентичных линий, последний общий предок которых жил, скажем, за две тысячи лет до того, как они попали на корабль к викингам. Так что иногда всё не так-то просто объяснить.


Интервьюер: Может, инуитские корни — это возможно?


Томас Кран: Да, мы знаем, что инуиты — это гаплогруппа Q, но это другая линия гаплогруппы Q, в действительности независимая от них.


Интервьюер: Когда мы говорим о всяческих миграциях, у нас возникают общие вопросы о том, откуда вообще люди взялись. Наверное, вы можете высказать какие-то соображения по этому поводу?


Томас Кран: Ну, тогда давайте от истоков. Итак, вы в курсе, что существует Денисовская пещера на Алтае, в России. И мы уже знаем некоторые ранние виды людей, которые были в какой-то степени развитыми: они были охотниками, жили в пещерах, у них была какая-то культура, может быть, примитивные рисунки — не знаю точно, спросите у антропологов. Но, в общем, они были людьми. Долгое время геном неандертальцев не был полным, потому что все секвенированные неандертальцы были девочками. Так что у нас была некоторая проблема, и это наблюдалось пару лет: «следующий опубликованный геном — снова неандертальский. Проклятье, опять девочка!» Это не давало никакого вклада в моё исследование Y-хромосомы. Но, к счастью, в прошлом году появилась пара мужских последовательностей из разных стран. Кроме этого, удалось получить очень разреженные мужские последовательности денисовской ДНК. Похоже, там копали ещё и ещё и нашли несколько костей и идентифицировали их по ДНК. Так что, случаются интересные вещи. Так, теперь... Мы стараемся использовать эти очень скудные данные. Это как если человек, посмотревший свой BAM-файл, остался недоволен десятикратным покрытием, то он бы очень удивился, узнав, что в денисовском или неандертальском образце покрытие менее чем однократное. Очень сложно определить, где шум, а где — реальная информация. К сожалению, мы очень мало знаем об этом — о химии деградации ДНК. Итак, мы видели признаки деградации ДНК в этих мутациях. Если есть мутация из цитозина в аденин, всегда нужно быть осторожным. Это значит, что полимераза отремонтировала последовательность неправильно, так как на самом деле основание отсутствовало, деградировало. Таким образом мы можем определить, какая ДНК — старая, а какая — современное загрязнение, бесполезная ДНК. И, опять же, для оценки мутаций в этой последовательности мы можем взять только неповреждённую ДНК. И когда есть разреженное распределение прочитанных участков по референсной последовательности, только короткие сегменты там и сям, нужно быть очень, очень удачливым, чтобы найти случайное место, где в денисовской и неандертальской последовательностях сегменты ДНК совмещаются друг с другом и чтобы именно в этом месте была ещё и мутация. Так, на всех этих двадцати миллионах оснований Y-хромосомы мы нашли всего горстку, где-то двадцать мест, где мутации у денисовцев и неандертальцев могли бы совпадать. И тогда мы берём человеческую референсную последовательность, последовательность шимпанзе, может быть, гориллы, и сравниваем: есть ли между ними некоторая преемственность? Видим ли мы определённое направление? Во всех этих огромных [референсных] участках есть множество мутаций, потому что между ними десятки тысяч лет. Найти общие мутации — это как искать иголку в стоге сена. Но последовательно группы, которые опубликовали данные ДНК, и мы, анализируя эти последовательности на наших референсах, используя наши сравнительные данные, в том числе с нашей последовательностью A00, мы нашли одинаковые структуры. Что говорит нам о том, что денисовцы и неандертальцы — это не одна группа, но происходят из одной ветви. Сначала отделились денисовцы, и у нас осталась ветвь сапиенсов и неандертальцев. Потом неандертальцы и люди разделились.


Интервьюер: Так что, денисовцы отделились раньше?


Томас Кран: Намного раньше, чем неандертальцы от нас, от нашей главной линии.


Интервьюер: Спасибо, Томас. Я думаю, это всё.

Показать полностью 4
97

Пересадка почки: от«сборища дураков» до Нобеля

Пересадка почки: от«сборища дураков» до Нобеля Трансплантация, Почки, Генетика, ДНК, Анестезия, Биотехнологии, Видео, Длиннопост

23 декабря 2019 года исполнилось 65 лет с тех пор, как доктор Джозеф Мюррей в госпитале Питера Бента Бригэма в Бостоне, штат Массачусетс, впервые провел успешную операцию по трансплантации почки. В 1990 году Мюррей получил за это Нобелевскую премию по медицине. Об истории трансплантации органов, об эскулапах -бессребрениках,  и о том, зачем людям свиные сердца, - в этом посте.


Благодаря революционному методу доктора Мюррея удалось спасти более полумиллиона жизней. Тогда, в 1954 году, наблюдая за врачами, готовящимися провести первую пересадку почки от здорового брата-близнеца больному, коллеги называли их за глаза «сборищем дураков». Но Джозеф Мюррей не обращал на них внимания – и оказался прав. «Если вы будете беспокоиться о том, что говорят люди, вы никогда не добьетесь прогресса», — сказал 90-летний Мюррей, выступая на мировом симпозиуме трансплантологов.


Наверное, таким отважным людям, как этот бостонский хирург, мы обязаны многими новшествами, которые вначале страшат и изумляют, а потом становятся частью повседневной жизни. К счастью, новаторы существовали даже в очень далекие времена.


История трансплантологии: от святых Козьмы и Дамиана до наших дней.


По преданиям, в 4-м веке до н.э. китайский врач Пиен Цяо обменивал друг с другом сердца человека с сильным духом, но слабой волей, и человека со слабым духом, но сильной волей в попытке достичь равновесия в них обоих. О том, как он измерял силу воли и духа, остается только догадываться. Как и о результатах смелого эксперимента.

Козьму и Дамиана – братьев, святых-бессребреников, живших в конце 3-го – начале 4-го века н.э., также причисляют к отцам трансплантологии, хотя, согласно легенде, эти целители проявили искусство пересадки частей тела через тысячу лет после своей смерти. Житие святых гласит, что они явились во сне дьякону Юстиниану, у которого сильно болела нога – никакие лекарства не помогали. Святые отрезали его больную ногу и пришили вместо нее конечность умершего мавра. Наутро Юстиниан проснулся здоровым – хотя и двухцветным..

Пересадка почки: от«сборища дураков» до Нобеля Трансплантация, Почки, Генетика, ДНК, Анестезия, Биотехнологии, Видео, Длиннопост

Основатель индийской медицинской школы Сушрута, живший предположительно в 8-м веке н.э., не во сне, а наяву использовал аутотрансплантацию кожи при пластической операции носа. В 16-м веке итальянец Гаспар Тальякоцци также успешно применял ринопластику.


Достижение Джозефа Мюррея базировалось на более чем столетнем опыте его коллег —чеха Эдуарда Цирма, в 1837 году пересадившего роговую оболочку глаза, швейцарца, нобелевского лауреата Теодора Кохера, впервые в 1883 выполнившего трансплантацию щитовидной железы, американца Чарльза Гатри, который с коллегой-французом Алексисом Каррелем пересаживал вены и артерии.

Анестезия: Made in МА.

Все эти эксперименты, конечно, были бы невозможны без анестезии. 16 октября 1846 года массачусетский дантист Томас Мортон впервые применил эфир в качестве обезболивающего средства.

Как отмечает энциклопедия Брокгауза и Эфрона, «пациент начал испытывать приятное чувство благости и легкости в теле» и не реагировал на боль. Аудитория в местной больнице, где была сделана операция, занесена в Национальный реестр исторических памятников США.

Слово «анестезия» тоже родом из Массачусетса: его придумал бостонский писатель Оливер Холмс. Вскоре появилась врачебная специальность — анестезиология, а День анестезиолога во всем мире отмечают 16 октября (теперь вы знаете, почему).


Но вернемся к первому реципиенту донорской почки Ричарду Хэррику. Он прожил еще почти 10 лет, женился на операционной медсестре и стал отцом двоих детей.Конечно, оперировавшего его и его брата доктора Мюррея терзали сомнения: «Нас, врачей, учили не причинять вреда. Но, оперируя здорового человека, извлекая у него почку пусть даже с его согласия, мы делаем это без пользы для донора», — рассказывал он. На вторую операцию по пересадке почки в 1956 году потребовалось разрешение Верховного суда Массачусетса. Сегодня это уже история трансплантологии: в США трансплантацию органов по жизненным показаниям покрывает медицинская страховка, врачи успешно пересаживают не только почки, но и сердце, печень, легкие, поджелудочную железу, кишечник, сетчатку глаза и даже лицо.


В 2009 году хирурги в больнице Brigham and Women’s Hospital выполнили вторую в мире пересадку лица, которая понадобилась человеку после укуса гориллы. Операция проходила одновременно в двух операционных и длилась 17 часов. В 2011 году там же 14 хирургов при поддержке 36 анестезиологов, рентгенологов, медсестер в течение 12 часов работали над трансплантацией обеих рук 65-летнему мужчине, потерявшему руки в результате инфекции.


Massachusetts Eye and Ear Infirmary также успешно пересаживает роговицу глаза, возвращая людям зрение. Долгие годы этот медицинский центр был в числе мировых лидеров по данной специализации, которая возвращает зрение 150 тысячам людей в год; сейчас центр занимает 4-е место в мире по проводимому количеству таких операций. С накоплением клинического опыта трансплантация органов становится все более обыденной процедурой. И, хотя в Соединенных Штатах ежегодно проводится более 30 000 трансплантаций, в списках ожидания — 113 000 пациентов, а 20 человек ежедневно умирают, так и не дождавшись операции.

Пересадка почки: от«сборища дураков» до Нобеля Трансплантация, Почки, Генетика, ДНК, Анестезия, Биотехнологии, Видео, Длиннопост

3D-печать органов: сердце можно напечатать или одолжить у свиньи


Поскольку будущее — за биотехнологиями, ученые видят выход в 3D-печати органов. До сих пор, однако, это было из области научной фантастики — что-то вроде очередной серии из «Черного зеркала». Ведь все человеческие ткани с 3D-печатью не имели необходимой клеточной плотности.


И вот в апреле 2019 года исследователи из Института биоинженерии клеток при Гарвардском университете (Wyss Institute for Biologically Inspired Engineering) и Школа инженерии и прикладных наук Гарвардского университета (John A. Paulson School of Engineering and Applied Sciences) применили новую технологию печати клеток SWIFТ. Она включает в себя двухэтапный процесс, который начинается с формирования сотен тысяч агрегатов, полученных из стволовых клеток пациента, в плотную, живую матрицу OBBs, содержащую около 200 млн клеток на миллилитр.


На втором этапе матрица внедряется в организм человека, образуя новый орган. Внутри матрицы, созданной с помощью SWIFТ-технологии, можно напечатать широкую сеть каналов, имитирующих кровеносные сосуды. Таким образом печать органов на 3D-принтере достигла совершенно нового уровня.

Еще один стартап, еGenesis из Кембриджа с профессором генетики Гарвардской медицинской школы Джоржем Черчем (George Church) в качестве соучредителя, пытается с помощью CRISPR-технологий изменить геном свиней и сделать их органы совместимыми с человеческими. Тогда можно будет, например, пересаживать свиные сердца непосредственно людям, не боясь их отторжения. По словам Черча, необходимо провести еще множество испытаний, прежде чем это станет возможным, и ученые работают над этим.

Показать полностью 2 1
324

От ДНК до белка. Базовые вещи

Очередная озвучка. Анимационный ролик о процессе считывания генетической информации из ДНК и последующем процессе синтеза белка. Всё на базовом уровне, без лютой биохимии, под забавную музыку. Расслабляйтесь, на следующей неделе будет уже серьёзный ролик.


Перевод и озвучка мои.

Исходник видео: https://www.yourgenome.org/video/from-dna-to-protein (лицензия Attribution 4.0 International (CC BY 4.0))

Музыка: Andrew Huang - Accordion.

Похожие посты закончились. Возможно, вас заинтересуют другие посты по тегам: