266

Функционирование ДНК показали в удивительной анимации

Медицинский научно-исследовательский институт "Уолтера и Элизы Холл" в Австралии, создал некоторые анимации для имитации функции ДНК в клетках нашего организма. Ролик был показан на выставке «Будущее начинается здесь» 2018.


Дубликаты не найдены

+17

Меняю всегда поражало, как из каких-то атомов, совершенно не живых, образуются такие сложные работающие системы. Как все эти белки и ферменты работают слаженно круглосуточно...

А в результате всего их труда я сижу мемы смотрю

раскрыть ветку 6
+7

У многих людей, поглубже вникающих в устройство Вселенной, возникают мысли, далекие от атеизма.

Все так практично, логично и сверхсложно устроено на разных уровнях.

раскрыть ветку 4
+5
Разве? Должен ли накрывать бред учёных мужей? Или иногда люди просто сходят с ума?
эти шайтан машинки не очень практичны на самом деле. У них достаточно высокий процент брака, а у контрольных юнитов не 100% успех по очищению от брака.
физика и химия логичны, почему биологии не быть?
о, сверхсложно это убедить христанутых не ебашить детей в купель с сомнительной жижей и блевотой предыдущего мученика.
А тут ничего сложного, немного биохимии, чутка биофизики, щепоточка комбинаторики и теорвера...
+2
Вот вот. С другой стороны. Бородатый старик на облаке, который после твоей смерти тебя будет судить, это пиздец.
раскрыть ветку 2
0
Да и сами мемы-это всего лишь последовательность нолей и единиц
+15

Не отвлекайте меня, я очень занят на клеточном уровне

+19

И вся  эта красота  внутри меня... Как я живой-то ?

раскрыть ветку 7
+11

Похожее видео с русской озвучкой https://www.youtube.com/watch?v=cmE4jO8iPS0

раскрыть ветку 6
+1

Спасибо, с озвучкой интереснее.

раскрыть ветку 2
0
Спасибо!!
0

Еще есть "Тайная Вселенная: Путешествие внутрь клетки"

раскрыть ветку 1
+7
Ахуеть там производство. Наглядно що пиздец, спасибо за видео!
раскрыть ветку 3
+2

Сатисфактори и факторио отдыхают

раскрыть ветку 2
0

factorio знаю, а что за сатисфактори?

раскрыть ветку 1
+4

Очень круто

+3

Кушать подано!

Иллюстрация к комментарию
раскрыть ветку 1
0

Тоесть мы состоим из пастилы?

+7

Одно не понятно, каким образом эти механизмы работают, что ими управляет? Я так понимаю, что нервы состоят из ДНК, в таком случае самый тонкий нерв, всегда будет больше одного "механизма"... Обладают ли данные "устройства" личным сознанием, программой?

Пожалуйста, объясните кто знает. Как они понимают, когда надо что-то оторвать, приклеить, скопировать?;) В них тоже есть рецепторы (сенсоры)?

раскрыть ветку 8
+6

Да, самое сложное, это осознать, что все это дело двигается именно так, просто потому что по-другому не может. Все это законы физики и химии, безо всякого сознания.

В одной из книг Ника Лейна(биохимика) мне понравилась аналогия с https://ru.wikipedia.org/wiki/Машина_Голдберга , только действия не простые, а сложные и их миллиарды.

+5

Грубо говоря это что то между гидравликой и механикой.  Свойства определяет среда. Но это не точно

+5
Управляет этим всем нервная система путем выделения определённых веществ/гормонов и т.д. Нервы состоят из клеток, объединённых в волокна, которые составляют ткань. ДНК же пронизывает все клетки организма и носит информацию. Насчёт обладания самосознанием: я думаю, что в отдельности - нет, а вот в объединении - да, ибо мы из них состоим и самосознанием обладаем.
раскрыть ветку 5
+11

Управляют всем этим законы химии. Вся эта визуализация показывает каскад сложных, но химических реакций.

+6

Клетки вообще то отлично делятся в питательной среде без всякой указки со стороны мозга

0
Мы их Бог
раскрыть ветку 2
+1
Вопросов стало только больше.
1. Как эти сгустки перемещаются?
2. Как они находят правильное место, куда прицепиться?
3. ???
раскрыть ветку 8
+6

На уровне микромира  все   происходит  не так как  нам привычном нам макромире.  Боюсь ошибиться в порядке, но вроде бы около миллиарда раз в секунду молекула воды испытывает столкновения с другими молекулами.

1) "Сгустки" не перемещаются целенаправлено, как может показаться, они колебаются  миллиард раз в секунду  пока не попадут в положение в котором может произойти реакция.

2) Это обеспечивается в том числе структурной формой молекулы, расположением полярных групп атомов.


От непонимания этого и   возникают теории  типа " клетка слишком  сложна  для того чтобы  все происходило случайным образом  — молекулы белка обладают разумом" или как вариант " молекулы клетки управляются божественной волей".

+5

1. По законам физики.

2. По законам физики.

3. Да.

раскрыть ветку 5
0

а кто ловит тех, кто нарушает законы?

и что им за это будет?

и кто следит за тем, чтобы при этом не нарушались их права?

раскрыть ветку 2
0

2 - Скорее химии, а потом уже физики.

раскрыть ветку 1
+4

1. бригадами такелажников

2. бригадир говорит что и как

3. .

0
Иллюстрация к комментарию
0

А что не показали на видео как работает теломера ДНК, которая определяет предел Хейфлика?

0

Да человека делали...

-6
В шоке от увиденного. Как в коммос слетала(. Нет, я конечно в курсе про молекулы и днк, но что там идет ( не просто существует) , а идёт процесс постоянно и такой неслабый...даже в голову не приходило. И после увиденного кто то еще признает теорию взрыва? Что он породил такой четко отлаженный природный механизм? Еще раз убеждаюсь, как мы примитивны, чтобы рассуждать о Боге, о вселенной. Видео потрясное!
раскрыть ветку 4
+7

«Любая развитая система неотличима от магии» — интерпретация закона Кларка. Кто-то видит шевелящиеся ниточки — и восторгается сложностью «замысла», а кто-то видит перенос азотистых оснований в молекуле дезоксирибонуклеиновой кислоты. Последнему некогда восторгаться, он хочет знать, почему однажды в отдельно взятой вселенной аденин «полюбил» тимин.

+2

Просто недостаток образования. Все происходящее хорошо объяснено химией и физикой.

раскрыть ветку 2
-1
Епрст. Перевожу. Я в курсе химии и физики, но я кажется говорила о том, что я восторгаюсь тем, что этот процесс кто то запустил и идеально отладил этот механизм . Из хаоса не возникнет ни ваша химия, ни физика
раскрыть ветку 1
ещё комментарии
-2
Баян же, пол года назад тут было
раскрыть ветку 2
+11
Такую красоту не грех и повторить, чтобы больше пользователей увидело.
0
да лучше пусть такие баяны будут, чем ибливые скрины комениариев. Накуй их вообще пропускают модеры. Тот же баян, только другим боком. Лишь бы плюсов рубануть
-1

Конечно можно говорить что это определённые белки работающие от витамина или гормонов, но...я вижу здесь чёткую работу механизмов. Это сложная работа,не имеющая права на ошибку, выполняется с очень большой скоростью чётко отработанными действиями. Человек видит набор белков, так как это за гранью нашего понимания и мы физически не смогли бы повторить этот процесс. Это как сложная компьютерная программа , которая фиксит и копирует сама себя. Даже как то не верится что такое могло появится само по себе...

-1
Спички есть, бензин есть поджигать после того что увидел.
Похожие посты
89

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные

Через Уральский регион проходили многочисленные миграционные маршруты, которые, помимо прочего, повлияли и на историю Европы. Археологические свидетельства этих событий можно наблюдать на раннесредневековых кладбищах Южного Урала. Для этой территории типичны компактные кладбища с несколькими сотнями гробниц, которые впервые за последние 10–15 лет стали источником богатых археологических находок. Согласно археологическим, лингвистическим и историческим данным, корни современных венгров можно проследить до Уральского региона. Судя по лингвистическим свидетельствам венгерский язык, принадлежащий к финно-угорской ветви уральской языковой семьи, возник к востоку от Урала, где-то между 1000 и 500 годами до н. э. Вероятно, после VI века н. э. часть предков венгров переселилась со своей древней родины в Предуралье, т.е. на территории, прилегающие к западному склону Урала. А примерно, в первой трети IX века н. э., часть этого населения Предуралья, под давлением Хазарского каганата пересекла Волгу и заняла Северное Причерноморье, вступив в союз с хазарами.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

При этом, конец IX века характеризуется началом упадка хазарского мира, в котором особую, но не единственную, роль сыграли печенеги. Также немаловажным было и формирование Древнерусского государства с выходом из-под контроля хазар части восточнославянских племён. Ранние венгры жили в Восточной Европе (формируя так называемый "субботцевский горизонт" ещё до того, как они вторглись в Паннонию, уже в более разнообразном составе. В X веке, материальные черты Карпатского бассейна быстро менялись после завоевания, с многочисленными археологическими свидетельствами связей с восточноевропейскими регионами, которые прослеживаются до Урала. Однако генетических данных от доисторического периода до средневековых популяций Уральского региона не так много в отличии от средневековых популяций Карпатского бассейна. В более ранних работах авторы предположили, что смешанные популяции степных кочевников (среднеазиатских скифов - саков) и потомков восточноевропейской срубной культуры, помимо других неописанных популяций, могло быть основой генетического состава венгерских завоевателей. Кроме того, предыдущие результаты предполагают генетические связи венгерских завоевателей с гуннами, а также с их предшественниками хунну. В последних статьях, которые касались изменчивости отцовских линий элиты венгров, они описывались как генетически неоднородные, со значительной долей европейского, финно-угорского, кавказского и сибирского или восточноевразийского вклада по отцовской линии.

Из чего следует, что мужские предковые линии венгерских завоевателей были из трёх отдалённых источников, а именно из Внутренней Азии (Байкал — Алтайские горы), Западной Сибири — Южного Урала (финно-угорские народы) и Причерноморья — Северного Кавказа (северокавказские тюрки, Аланы и восточноевропейские популяции того времени).

Оба вышеупомянутых исследования указали на присутствие Y-гаплогруппы N1a1a1a1a2-Z1936, ранее известной как N3a4-Z1936 в составе N-Tat / M46), которая часто встречается среди народов, говорящих на финно-угорских языках.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Эта линия также встречается среди современных венгров с частотой до 4%. В последующих работах исследователи реконструировали детальную филогению Y-гаплогруппы N-Z1936, показав, что определённые её субклады являются общими для некоторых этнических групп, как к примеру, N-Y24365 / B545 встречается у татар, башкир и венгров и связывает современных венгров с людьми, живущими в Волго-Уральском регионе.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Более ранние исследования митохондриальной ДНК современных популяций, говорящих на уральских языках, предполагают, что распространение линий мтДНК Восточной и Западной Евразии определяется географическими расстояниями, а не языковыми барьерами. Например, финно-угорские популяции из Волго-Уральского региона, по мтДНК, кажутся более похожими на своих тюркоязычных соседей, чем на родственные по языку прибалтийско-финские этнические группы. Более свежее исследование (от 2018 года) 15 уралоязычных популяций, также описывает их сходство с соседними популяциями, но помимо этого указывает ещё и на дополнительный компонент, возможно, сибирского происхождения.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Однако несмотря на то, что некоторые митохондриальные линии современных венгров имеют возможное сибирское происхождение, их генофонд отличается от других уралоязычных народов.


ЦЕЛЬ ИССЛЕДОВАНИЯ


При сборе 36 образцов древней ДНК из Уральского региона, наиболее важным намерением было подобрать профессионально раскопанные и задокументированные захоронения Южного Урала, которые культурно или по времени связаны с предками венгров. При этом наибольшее сходство с археологическими памятниками Карпатской котловины X века продемонстрировал археологический памятник Уелги Южного Зауралья, Кунашакского района Челябинской области. Это кладбище использовалось с позднего периода кушнаренковской культуры в VIII веке и по XI век.

Учитывая различные взгляды на события того времени в регионе, авторы работы стремились охватить широкий спектр раннесредневековых археологических культур, расположенных в среднем течении Камы к западу от Урала.

Учёные связывают прекращение существования неволинской культуры в VIII – IX веках н. э. с миграцией на запад предков венгров, поэтому отбор образцов проводился во всех трёх группах этой культуры: бродовской (III – IV вв.), бартымской (V – VI вв.) и сухоложской (VII – VIII вв. н. э.). Помимо этого, был исследован Бояновский могильник (IX – X вв. н.э.) в Добрянском районе Пермского края. Этот археологический участок представляет собой южный вариант ломоватовской культуры, которая в свою очередь, демонстрирует тесную культурную связь с неволинской культурой из более южных регионов. Также, помимо новых образцов, было повторно проанализировано девять образцов древних венгров из Карпатского бассейна X – XII веков на предмет обнаружения целых митогеномов. Эти образцы были отобраны из предыдущего исследования на основе идентичных гаплотипов мтДНК с некоторыми из исследованных представителей Урала.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

А основная цель новой научной работы заключалась в том, чтобы охарактеризовать материнский и отцовский генетический состав популяций Южного Урала с III по XI в и сравнить результаты с доступными древними и современными наборами генетических данных Евразии. Авторы работы также стремились описать возможные генетические связи между изученными уральскими популяциями и популяциями периода завоевания Карпатского бассейна.


ВЫВОДЫ


Уральский регион играл важную роль в этногенезе древних венгров, основываясь на археологических, лингвистических и исторических источниках, хотя результаты этих исследований демонстрируют различия в хронологическом и культурном аспектах. Представленные новые данные о мтДНК, Y-хромосоме и аутосомной последовательности ДНК образцов Южного Урала также подтверждают актуальность региона с точки зрения популяционной генетики. Общий материнский состав исследованных образцов из Уральского региона с филогенетической и филогеографической точек зрения предполагает смешанное западное и восточное происхождение компонентов, хотя отцовские линии более однородны, с Y-гаплогруппами характерными для Волго-Уральского региона. Гаплогруппа Y-хромосомы N-M46 с субкладами составляет 83,3% остальные представлены гаплогруппами G2a (G-L1266), J2 и R1b.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Также стоит отметить, что точно отнести каждый митохондриальный гаплотип Уелги к западному или восточному не представляется возможным, но представители обоих направлений присутствуют. Митохондриальные гаплогруппы европейского происхождения N1a1a1a1a и H40b предполагают, что существовала базовая популяция с характеристиками ближе к западным. С другой стороны, схожие (С4а1а6) или единичные (A, A12a, C4a2a1) восточные гаплотипы, отчётливо заметные в третьем (сухоложском) горизонте, предполагают относительно недавнюю примесь к основной популяции.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Однако очевидному сосуществованию генетического и археологического сдвига, противоречат однородность предковых компонентов и отцовского состава, а также анализ главных компонент и наличие восточного вклада С4а1а6 во всех горизонтах.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Хотя сам факт однородности по отцовским линиям можно объяснить патрилокальностью. Несмотря на то, что генетический вклад популяции, относящейся к сросткинской культуре Северного Алтая и южных районов Западной Сибири исключать нельзя, более вероятно, что большинство восточных компонентов смешалось ещё до начала использования уелгинского могильника. Материнские и отцовские линии древнего населения Уелги сигнализирует о том, что они хронологически и/или географически связаны с возможным генетическим источником венгерских завоевателей. Т.е. не с самими древними венграми, а с их предками. Помимо этого, захороненные на кладбище Уелги, по предварительным аутосомным данным, разделяют свой частотный состав аллелей с современными уральскими и западносибирскими популяциями, которые лингвистически или исторически связаны с венграми, что обеспечивает хорошую почву для будущих исследований.

Что касается материнских линий, то связи древних жителей Уелги с венгерскими завоевателями можно разделить на прямые и косвенные. Косвенные могут исходить от базовой популяции Южного Урала с более европейским генетическим профилем, в то время как прямые связи характерны преимущественно для смешанного восточного компонента. Одним из возможных объяснений этого феномена является то, что древние венгры и жители Уелги в прошлом имели общих предков и у этих предков уже была восточная примесь, которая впоследствии попала к обеим группам. Точное происхождение восточного компонента ещё предстоит описать, однако некоторые косвенные связи указывают на Центральную Азию. На графике анализа главных компонент, древние жители Уелги расположились в районе представителей окуневской культуры бронзового века, а также между уралоязычными группами и тюркоязычными популяциями Центральной степи.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка
Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Также филогенетический состав популяций Предуралья ставит под сомнение их генетическую однородность и последовательность. Но чтобы это проверить, нужно больше данных.

В новой работе родственные связи с древними венграми носят единичный характер, однако при этом наблюдается региональная близость, которая более выражена на графиках анализа главных компонент и многомерного шкалирования.

Происхождение венгров и Уральский регион. История мадьяр, новые генетические данные Наука, История, Популяционная генетика, Длиннопост, Венгры, Южный Урал, ДНК, Видео, Гифка

Т.е. люди из этих популяций не являются прямыми родственниками, однако близки к ним. В целом исследование демонстрирует генетическую связь между Зауральем, Предуральем и Карпатским бассейном на разных уровнях. Анализ этого нового набора данных заполняет пробелы в популяционной генетике Евразии, а также дополняет и корректирует выводы, сделанные ранее.

В более ранних работах, основанных на генетическом составе венгерских завоевателей и хунну, о которых также упоминалось в роликах канала, сообщалось о связи древних венгров с различными восточными регионами. Однако в этих исследованиях не участвовали регионы Урала, где присутствие редких восточноевразийских гаплотипов в популяциях позднего железного века и раннего средневековья к западу от Урала (Предуралье), может изменить представление о контактах востока и запада в будущем.

В последующих исследованиях авторы планируют расширить набор генетических данных с высоким охватом и включить образцы из других восточноевропейских кладбищ древних венгров и соседних с ними общин.

Источник:

Csáky, V., Gerber, D., Szeifert, B. et al. Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians. Sci Rep 10, 19137 (2020). doi.org/10.1038/s41598-020-75910-z
Показать полностью 10
1907

20 интересных фактов и историй о человеческом мозге

20 интересных фактов и историй о человеческом мозге Мозг, Нейробиология, Наука, Память, Факты, Баян, Видео, Длиннопост

1. То, что кажется случайным светом, когда вы ударяетесь головой, на самом деле просто поражает клетки мозга, отвечающие за зрение. Эти визуальные “галлюцинации” – это реакции вашего мозга.


2. Когда вы впервые спите в новой среде, мозг обрабатывает опасность и остается в полусне, чтобы быть более осведомленным.


3. По словам исследователей из Калифорнийского университета в Лос-Анджелесе, люди впервые испытали приступ тревоги или депрессии сразу после болезней желудка. Используя сканирование головного мозга, они обнаружили, что у пациентов, которые ели пробиотики, мозг подвергался прямому воздействию бактерий. Все их исследования показывают, что микробное здоровье желудка оказывает гораздо большее влияние на ваш мозг, чем считалось ранее. Наша статья на эту тему – "Микробная психиатрия".


4. Человек по имени Брюс Бриджмен провел почти всю свою жизнь, 67 лет, без способности к глубинному восприятию, называемому стереослеплением. Однако после того, как его заставили купить 3D-очки для просмотра фильма в кинотеатре, он смог испытать 3D-зрение.


5. Мужчина в Великобритании имел хроническую икоту в течение 2,5 лет своей жизни, и ему сказали, что это, вероятно, вызвано изжогой. После того, как японское телешоу обнаружило это странное явление и оплатило медицинское обследование, была обнаружена опухоль головного мозга. Как только у мужчины была удалена опухоль, его хронические икоты исчезли навсегда.


6. Провалы в памяти после алкоголя на самом деле вызваны воздействием алкоголя на гиппокамп, часть вашего мозга, отвечающая за память. Вы ничего не забываете физически, скорее ваш мозг становится неспособным хранить и записывать новые воспоминания.


7. Мы плачем, когда очень счастливы, потому что наш гипоталамус в нашем мозгу не может отличить сильное счастье от грусти.


8. Мы получаем озноб, когда слушаем музыку в результате высвобождения допамина нашим мозгом.


9. Одиночное заключение может на самом деле нанести огромный неврологический ущерб человеческому мозгу. Настолько, что это можно увидеть при сканировании ЭЭГ, и мозг одиноких заключенных имеет те же показатели, что и у людей, получивших травматические повреждения.


10. Пока мы спим, наша спинномозговая жидкость течет через мозг снаружи кровеносных сосудов мозга. Это удаляет отходы клеток мозга, специфические накопления белка бета-амилоида.


11. Ученый по имени Теодор Эрисманн создал очки, которые полностью изменили его зрение, он наблюдал все в перевернутом виде. Сначала он боролся с перевернутым восприятием, но всего за 5 дней его мозг адаптировался к изменениям, и он увидел все как обычно. Этот тип адаптации также хорошо продемонстрирован ютубер «Smarter Every Day», который забыл, как ездить на велосипеде. Ютубер перевернул рулевое управление своего велосипеда таким образом, что поворачивая вправо – велосипед направлялся влево. Таким образом он заставил себя забыть, как ездить на привычном нам велосипеде, но в итоге переучился(видео) ниже.

12. Болезнь Альцгеймера вызвана сопротивляемостью к воздействию инсулина в головном мозге, в результате чего многие называют его диабетом 3 типа.


13. Человеческий мозг получает 20% от общего количества кислорода от нашего тела, хотя они составляют только 2% веса нашего тела. Подробнее в статье: “Умный мозг не только большой, но и жаждущий крови“.


14. 73% вашего мозга – это просто вода, а это значит, что если вы обезвожены более чем на 2%, вы можете страдать от потери внимания, когнитивных навыков и памяти.


15. Зевание – это реакция, которая посылает больше кислорода в ваш мозг. Рептилии, птицы и млекопитающие все зевают, и это контролируется нейротрансмиттерами(нейромедиаторами) в мозге.


16. Мозжечок – это часть мозга, отвечающая за осанку, ходьбу и координацию движений. Он расположен в задней части мозга и весит всего примерно 150 грамм.

20 интересных фактов и историй о человеческом мозге Мозг, Нейробиология, Наука, Память, Факты, Баян, Видео, Длиннопост

17. Исследователи из Университета Бэйлор обнаружили, что у детей, лишенных касаний, игр и общения с другими, мозг на 20-30% меньше, чем обычно для их возраста. Таким образом, жестокое обращение с детьми может тормозить развитие мозга у ребенка и негативно влиять на его развитие в течение всей жизни.


18. Мозг не может испытывать боль. Это позволяет нейрохирургам исследовать участки мозга в то время, когда пациенты бодрствуют. Затем они могут получать обратную связь от каждого пациента в режиме реального времени, что позволяет им точно определять конкретные области, например, связанные речью или движением.

20 интересных фактов и историй о человеческом мозге Мозг, Нейробиология, Наука, Память, Факты, Баян, Видео, Длиннопост

Скрипачка играет на скрипке во время операции на мозге


19. Расчесывание зуда на самом деле является странным биологическим ответом с медицинской точки зрения. Кажется, что это мешает процессу заживления, а не помогает ему. Исследователи полагают, что мы зудим, потому что это стимулирует выброс эндорфинов, которые блокируют боль.


20. Каждый раз, когда вы что-то вспоминаете – вы укрепляете эту память в своем мозгу, ибо нейрохимический импульс укрепляет связь между нейронами.


Подготовка материала - 4everScience

Показать полностью 2 1
90

Забытая победа русского оружия в ходе Крымской войны

Крымская кампания 1853-1856 г. у всех, кто мало-мальски знаком с отечественной историей, ассоциируется с полным крахом, сокрушительным поражением Российской империи, которое привело к международной изоляции, подрыву влияния в Европе, утрате Черноморского флота и права иметь крепости в Причерноморье.


Однако в ходе этой войны на долю Российской империи выпали не только поражения, но и ряд славных побед, успешно использованных технических новинок и смелых военно-технических решений. Таковым я хочу посвятить небольшой цикл материалов.

Как Вы, должно быть, помните из школьных учебников, с октября 1853 по апрель 1854 года Крымская кампания развивалась как точная копия любой другой русско-турецкой войны.


На суше одну за другой одерживает победы русская армия, а на море 18 ноября 1853 года русская эскадра из 18 кораблей под предводительством адмирала П.С. Нахимова заперла в Синопской бухте турецкий флот в составе 16 кораблей и, завязав сражение под шквальным огнем турецких береговых батарей, смогла уничтожить турецкую эскадру и подавить орудия, не потеряв при этом ни одного корабля! Турки же потеряли решительно все... Только 20-пушечный быстроходный пароход "Таиф" смог вырваться из бухты. Командующий турецким флотом был взят в плен. Порвали османов на турецкий флаг, иначе не скажешь))) Кстати, в ближайшее время напишу о Синопской битве развернутый материал...

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

И.К. Айвазовский "Синопский бой".


Это сражение примечательно не только как блестящая победа русского флота, но и как последнее в мировой истории морское сражение, в котором ключевую роль играли корабли парусного флота. Отныне суда на паровом ходу всерьез и надолго установят свое господство в рядах военного флота любой державы.


Военный крах Османской империи, за которой к середине XIX в. закрепился образ "больного человека Европы", подстегнул европейские державы к участию в решении судьбы некогда могучей империи. У России с Францией еще до начала войны произошел ставший формальным поводом для войны дипломатический конфликт по вопросу контроля над церковью Рождества Христова в Вифлееме. Что тут сказать...

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

Англия, вопреки своему обыкновению, пошла на союз с Францией ради своих интересов на Ближнем Востоке. В состав коалиции также вошла Сардиния, которой взамен Наполеон III обещал помощь в борьбе за воссоединение и независимость Италии. Австрия и Пруссия заявили о своем нейтралитете, оставив Россию в изоляции.


В итоге с апреля 1854 года России объявляет войну новоиспеченная коалиция. Далее последуют бесславно проигранные сражения и, после долгой героической обороны, сдача Севастополя...

Однако я бы хотел поговорить о малоизвестном эпизоде, который предшествовал вторжению союзников в Крым...


Первым делом, первым делом пароходы)))


Свое участие в войне англичане и французы начали с небывалого масштаба провокации - союзники предприняли бомбардировки с моря и попытки высадки десанта возле ЕДВА ЛИ НЕ ВСЕХ важнейших баз военно-морского флота Российской империи. Англо-французская эскадра появилась в Балтийском море, атаковала Кронштадт и Свеаборг. Английские корабли вошли в Белое море и подвергли бомбардировке Соловецкий монастырь. В августе военная демонстрация была проведена и на Камчатке. 
Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

А.П. Боголюбов "Оборона Петропавловского порта 24 августа 1854 года"


Еще в марте гавайский король Камеамеа направил в Россию дружественное письмо, в котором сообщил о готовящемся нападении англо-французской эскадры. Губернатор Камчатской области - Василий Степанович Завойко, будучи человеком смелым и решительным, сделал все возможное, чтобы подготовить Петропавловск к обороне.

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

Портрет В.С. Завойко (1812-1898)


В распоряжении губернатора изначально было две с половиной сотни солдат гарнизона и семь орудий, однако в июле силы защитников пополнили 58-пушечный фрегат "Аврора" и транспорт "Двина", на борту которого прибыл батальон солдат, 2 бомбические пушки (гладкоствольные орудия, стреляющие разрывными снарядами) и 14 36-фунтовых орудий.


Теперь силы гарнизона увеличились до тысячи человек с небольшим. Пока неприятель, уверенный в своей победе, медлил, гарнизон возводил укрепления. В итоге к моменту нападения неприятельской эскадры вход в бухту преграждал сооруженный бон, 4 батареи и уже упомянутые два судна, готовые встретить врага залпом левого борта (орудия с правого борта были сняты для усиления береговых батарей).

16 августа гарнизон обнаружил приближение неприятельской эскадры. Англо-французские силы в себя включали 52-пушечный фрегат «Президент», 44-пушечный фрегат «Пайк», пароход «Вираго» вооруженный 6 бомбическими орудиями, 60-пушечный фрегат «Форт», 32-пушечный фрегат «Евридика», 18-пушечный бриг «Облигадо». На борту примерно 3 тысячи человек, включая морскую пехоту. Мягко говоря, силы неравные.


К непосредственному штурму порта супостаты приступили лишь 19 августа.

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

Под ураганную бомбардировку попали 1-я и 4-я батареи, однако, несмотря на потери, гарнизон выстоял и редкими (батареи в сумме насчитывали 16 орудий), но болезненными выстрелами сумели нанести серьезные повреждения фрегату "Президент".


На следующий день враг возобновил бомбардировку, "Облигадо" и "Эвридика" безуспешно пытались перекидным огнем повредить русские корабли и батарею №5. Основные силы тем временем подавили батареи №1 и №4 - их обслуга понесла большие потери, кроме того, ядра и бомбы настолько испещрили землю вокруг орудий, что поворачивать их не было возможности. Словом, боевые возможности оказались исчерпаны, а дальнейший героизм был бы бессмысленным. Поэтому уцелевшие артиллеристы запаяли собственные орудия, чтобы враг не обернул их против гарнизона, после чего отступили, пополнив личный состав батарей №2 и №3.


После падения внешней линии обороны неприятель пытается развить успех и к брошенной батарее №4 высаживается десант из 600 французских морских пехотинцев. Батарея №2 и русские корабли открывают огонь по неприятелю, к которому неожиданно присоединился английский пароход, ударив бомбой по уже захваченной русской батарее))) Friendly fire - вечная болезнь всех англосаксов)))


Понимая, что десант создает реальную угрозу уничтожения батарей и захвата порта, Завойко бросает в контратаку стихийно сформированный отряд солдат, матросов, добровольцев и артиллеристов числом в 130 человек. Должно быть, перепугавшись пресловутого владения русских солдат штыком, бурых медведей и генерала Мороза французы без всякого боя дали деру обратно на корабли)))


А во время этого фарса батарея №2 по-прежнему ведет артиллерийскую дуэль с неприятельской эскадрой. Бруствер надежно укрывает русские орудия и они наносят урон вражеским кораблям. К вечеру союзникам ничего не оставалось, кроме как уйти из бухты.


Второй штурм...


Провозившись четыре дня с ремонтом поврежденных кораблей, союзники 24 августа предприняли еще одну попытку штурма. Гарнизон тоже не сидел без дела и восстановил две ранее утраченных батареи, сведя на нет и без того скромные успехи союзников.


Далее все повторилось как под копирку - после нескольких часов шквального обстрела, союзники перебили половину обслуги орудий и подбили почти все русские пушки, при этом англо-французская эскадра получила ощутимые повреждения. Фрегат "Форт" тем временем, смог подавить батарею №3.

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

А затем враг провел сразу две высадки десанта - около 250 человек на перешеек у батареи № 3 и 700 человек у батареи № 7. Десанту была поставлена задача: первый отряд должен подавить батареи №6 и №7 (15 орудий в сумме) и оттуда стремительным ударом захватить Петропавловск; второму отряду предстояло занять Никольскую сопку и затем войти в город.


В реальности первый отряд, потеряв несколько десятков человек от картечных залпов, отступил на юг, на уже упомянутую сопку. То есть почти тысяча человек заняла господствующую над городом высоту. Казалось бы, дело почти сделано...

Но "русские варвары", 350 защитников города пошли в контратаку! Разбившись на небольшие отряды, бойцы гарнизона под шквальным ружейным огнем взбежали вверх по склону и в рукопашной схватке обратили врага в паническое бегство! До десантных ботов "доблестные" морпехи бежали под залпы ружей, теряя людей и остатки боевого пыла)))


Что тут еще добавить? О подвиге русских солдат красноречиво скажет соотношение потерь: неприятель недосчитался почти 500 солдат, русский гарнизон потерял менее полусотни человек. После этакого провала эскадра союзников с позором удалилась.


Когда узнал, что тысяча солдат, ополченцев и добровольцев на задворках страны смогла навалять знатных люлей целой эскадре врага)))

Забытая победа русского оружия в ходе Крымской войны История, Наука, Факты, Война, Военное дело, Военная история, Россия, Российская империя, Крымская война, Длиннопост

А на этом на сегодня все, спасибо за внимание!)

Показать полностью 6
303

Ответ на пост «Правда ли, что мечи никогда не носили за спиной?» 

Позволю себе выступить с резкой критикой.


В начале автор пишет, о неких "прямых доказательствах того, что традиция ношения клинкового оружия за спиной в Средневековье существовала".  После чего приводятся аргументы о наличии у воина другого оружия, вспомогательной роли меча, залезании на дерево и прогулкам по узким улочкам. Пока не буду разбирать эти аргументы, однако сразу скажу, что подобные рассуждения не могут считаться доказательствами существования традиции ношения оружия за спиной. Есть принципиальная разница между "могли делать" и "делали".


Далее идут ссылки на Кирпичникова, мягко говоря, совсем не по теме. В приведенных цитатах речь идет о способе крепления, а отнюдь не о положении меча. Перевязь через плечо или плечевая портупея - крайняя слева. Пояс или поясная портупея - центральная и справа.

Ответ на пост «Правда ли, что мечи никогда не носили за спиной?» История, Наука, Оружие, Меч, Средневековье, Военное дело, Факты, Ответ на пост, Длиннопост

При этом положение рукояти меча всегда +/- одно и то же.


Далее приводится изображение из погребения. Все бы ничего, но положение меча за спиной в погребении отнюдь не говорит о том, что его так носили при жизни.


После чего упоминается какая-то миниатюра, которую автору не удалось найти. Думаю, тут комментарии излишни.


Что мы имеем? Полное отсутствие прямых доказательств.


Что касается перечисленных выше рассуждений и домыслов... Они звучат малоубедительно. Да, порой воины таскали целый арсенал вооружения. Но он весь был функционален. Какой смысл носить оружие, которым не сможешь воспользоваться? Управлять конем оружие на поясе никак не мешает. Есть подозрение что меч за спиной, который будет при каждом такте галопа стучать по ней, мешает куда больше. Наконец, на изображениях сабля или меч всегда на поясе.

Ответ на пост «Правда ли, что мечи никогда не носили за спиной?» История, Наука, Оружие, Меч, Средневековье, Военное дело, Факты, Ответ на пост, Длиннопост

Залезание на дерево - не столь частое событие, чтобы ради него менять экипировку. Чтобы меч не бил по ноге - надо просто закрепить ножны как следует. А в городе меч будет твоим единственным оружием (остальное обычно носилось только на войне). Глупо носить его так, чтобы не иметь возможности применить. "Вспыхнула ссора, а у вас нет оружия под рукой, вот и помирились" - это что, простите, за детский сад?


Подытожу. Нет никаких оснований полагать, что ношение меча за спиной имело место в истории. Если бы такое действительно практиковалось - были бы подтверждения. Описания, изображения, специальные крепления на ножнах... Даже наполеоновские гренадеры, которым сабля в бою нафиг не сдалась, носили ее на поясе - просто сдвинув дальше за спину. Что же говорить о тех временах, когда меч действительно был оружием?

UPD: #comment_182664252

Существует изображение японского солдата с но-дати за спиной. Спасибо @SagaraA за изображение. Изображений с подобным ношением европейских мечей не встречал, двуручные мечи традиционно носили оперев гарду на плечо.
Ответ на пост «Правда ли, что мечи никогда не носили за спиной?» История, Наука, Оружие, Меч, Средневековье, Военное дело, Факты, Ответ на пост, Длиннопост
Ответ на пост «Правда ли, что мечи никогда не носили за спиной?» История, Наука, Оружие, Меч, Средневековье, Военное дело, Факты, Ответ на пост, Длиннопост
Показать полностью 3
80

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК

Приручение лошади около 5,5 тыс. лет назад представляет собой одно из важнейших технологических достижений древнего мира, поскольку лошади произвели революцию в транспорте и повлияли на модели торговли, войны и миграций. Археологические и органические остатки, а также генетический анализ позволяют предположить, что домашняя лошадь возникла в степях Центральной Азии, после чего распространилась по Восточной Европе, а затем и по Передней Азии. Данные из контекста ботайской культуры Казахстана предполагают, что к середине - концу четвёртого тысячелетия до н. э. лошадей могли содержать и доить. Но эти доводы оспариваются, потому как ряд учёных сочли доказательства одомашнивания лошадей ботайцами не убедительными, хотя и отметили хорошую работу исследователей, но подвергли сомнению интерпретацию результатов. Исследование геномов древних лошадей поставило под сомнение точку зрения о том, что современные домашние лошади произошли из Центральной Азии, поскольку было показано, что так называемые «ботайские» лошади являются предками лошадей Пржевальского в Северо-Восточной Азии, но не являются основным источником древних или современных домашних лошадей. Другое недавнее исследование исключило Пиренейский полуостров, как второй потенциальный центр одомашнивания лошадей, показав, что иберийские дикие лошади вымерли, не оставив заметных следов в геномах современных.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Однако оставалось ещё две области, которые были предложены в качестве центров приручения современных лошадей: это Причерноморско-Каспийская степь и Анатолия. Хотя степь уже долгое время считается наиболее вероятным источником домашних лошадей, Анатолия с этой точки зрения плохо изучена, несмотря на её долгую историю использования диких лошадей, а также репутацию как производителя ценных пород лошадей в античном мире. Комбинация текстов, изображений и археозоологических данных позволяет предположить, что к середине-концу III тысячелетия до н. э. домашние лошади были завезены из соседних горных регионов в Месопотамию (современный Ирак и северо-восток Сирии), где они часто упоминались в клинописных текстах как «горные ослы».

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Царь Ассирии Ашшурнацирапал II охотится на львов

Изначально содержавшиеся в небольшом количестве, лошади стали широко известны в Передней Азии в течение нескольких столетий в связи с распространением колесниц, технологического новшества второго тысячелетия до н. э.

Поскольку одомашнивание лошадей в евразийских степях, регионе, исторически известном своими так называемыми “конными культурами”, вероятно, началось в четвёртом или, возможно, даже пятом тысячелетии до н. э., долгое время утверждалось, что лошади Передней Азии являются потомками этих ранних одомашненных степных лошадей, которые прибыли в регион по средствам ещё недостаточно изученных процессов миграций или обмена с участием жителей Причерноморско-Каспийской степи и Кавказских регионов. Всего у лошадей, на данный момент выявлено 18 основных гаплогрупп (от A до R), время разделения которых относится в основном к неолиту и более поздним периодам.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Домашние лошади демонстрируют гораздо более высокую степень генетической изменчивости митохондриальных линий по сравнению с крупным рогатым скотом, а также свиньями и овцами. При этом, большинство митохондриальных линий, наблюдаемых у домашних лошадей, существовало ещё до приручения. Однако эти анализы древних лошадей не дали чёткой филогеографической структуры, которая позволила бы установить пространственно-временное происхождение и центр их одомашнивания. Ведь результаты предполагают, что лошади на севере Евразии постоянно мигрировали и смешивались. А вот что касается мужской линии, то у современных лошадей выявлен только один гаплотип, что привело к поспешным выводам о едином событии одомашнивания. Но анализ древних образцов указал на дополнительные мужские линии в доисторических популяциях до одомашнивания и показал, что генетически разнородные самцы-основатели участвовали в раннем одомашнивании.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Впоследствии это разнообразие сократилось, вероятно, в результате более направленного отбора человеком, который, скорее всего, начался в железном веке и продолжался во времена Римской империи и после VII-IX вв. н. э.

Палеогенетические данные по генетическим локусам, связанным с окрасом шерсти у лошадей, свидетельствуют об увеличении разнообразия окраса шерсти начиная с бронзового века, что считается ранней стадией процесса одомашнивания и является обычным явлением для домашних таксонов по сравнению с их дикими аналогами. Поэтому появление новых окрасов шерсти служит полезным маркером для идентификации домашних лошадей в археологических комплексах.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

До сих пор происхождение домашних лошадей в Анатолии оставалось малоизученным, однако тщательное извлечение останков лошадей из хорошо датированных археологических контекстов в Анатолии и на соседнем Кавказе, совместно с прогрессом в палеогенетических методах, теперь позволяет конкретно рассмотреть процессы, ответственные за происхождение домашних лошадей в этой части Передней Азии.

В своей работе международная группа исследователей объединила морфологическую классификацию останков непарнокопытных с палеогенетическим анализом митохондриальной ДНК, Y-хромосомы и аутосомных ДНК-маркеров, связанных с окрасом шерсти, для отслеживания пространственно-временной динамики появления домашних лошадей в Анатолии.

Чтобы прояснить давний вопрос в истории Ближнего Востока о местном приручении лошадей в Анатолии было проанализировано более 100 останков лошадей из 14 доисторических поселений Центральной Анатолии и Кавказа, охватывающих большую часть голоцена, а именно с 9-го тысячелетия до н. э. по 1-е тысячелетие н. э.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Результаты


Дикие и домашние лошади в Анатолии


Результаты позволяют сделать вывод о том, что домашние лошади были завезены на Кавказ и в Анатолию по крайней мере в 2000 г. до н. э., предположительно из Евразийской степи.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Этот вывод основан на том факте, что в Анатолии местные популяции лошадей до 6,5 тыс. лет назад несут только две митохондриальные гаплогруппы, P и X, причём последняя является ранее незарегистрированным гаплотипом, принадлежащим поддереву O-P-Q. До сих пор эти гаплогруппы не встречались где-либо ещё в Евразии в современном или более раннем контексте. Более того, гаплотип X, вероятно, имел ограниченное временное распространение в Анатолии голоцена, возможно, исчезнув после 5500 г. до н.э.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Данные подтверждают вывод о том, что эти две гаплогруппы отражают локальные митохондриальные признаки диких лошадей, на которых охотились в Анатолии в раннем и среднем голоцене. Исследователи предполагают, что гаплогруппы P и X развивались независимо в Анатолии в течение позднего плейстоцена и раннего голоцена со слабым или полностью отсутствующим потоком генов от соседних популяций диких лошадей из-за географических барьеров, отделяющих Анатолию от северной Евразии, а именно Босфора, а также гор Загрос и Кавказа. Таким образом, новое исследование предоставляет первые доказательства того, что Анатолия была домом для генетически отличающейся популяции диких лошадей, которые, согласно археозоологическим находкам, широко использовались в периоды неолита и энеолита. Остатки лошадей раннего неолита Ашиклы-Хююк, неолита / энеолита Кёшка-Хююк и позднего энеолита / раннего бронзового века Чадир-Хююк, являются представителями этих диких анатолийских лошадей.

А примерно в 2000 г. до н.э. наблюдается статистически значимое снижение частот местных митохондриальных линий диких лошадей, поскольку гаплогруппа P становится редкой, а гаплотип X полностью исчезает. Хотя низкая частота гаплотипа X у лошадей отмечена ещё до бронзового века.

Параллельно с этим, разнообразие материнских линий у лошадей Кавказа и Анатолии заметно возросло от 2 до 14, т.е. уровня современных, а также лошадей эпохи энеолита, халколита и ранней бронзы из Юго-Восточной Европы и Казахстана.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

В исследованиях лошадей Евразийской степи, митохондриальные гаплогруппы не демонстрируют филогеографической структуры в Евразии, что согласуется с отсутствием значительных физических барьеров в обширных евразийских степях. Это предполагает, что у популяций лошадей степи был постоянный обмен генетической информацией между её членами, что, вероятно, объясняет высокое разнообразие современных популяций домашних лошадей. Это также объясняет быстрый рост разнообразия, наблюдаемый в наборе данных из этого исследования при внедрении лошадей на Кавказ и в Анатолию. Это внезапное появление неместных родословных совпадает с появлением иконографических и эпиграфических свидетельств о лошадях и верховой езде в конце третьего тысячелетия до нашей эры и свидетельствует о значительном импорте домашних форм и, следовательно, против независимого местного процесса одомашнивания. Результаты, полученные при генотипировании аллелей, связанных с вариациями в цвете шерсти, подтверждают этот вывод, поскольку лошади бронзового века в Анатолии и на Кавказе демонстрируют мутации, соответствующие вариантам окраски шерсти, которые, как считается, были выбраны во время одомашнивания в евразийских степях, например, каштановый, чёрный и серебристый.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

А мутации, связанные с разбавлением цвета шерсти или пятнами, появились позже, после 1200 г. до н.э. согласно данным исследования. Таким образом, исходя из новых генетических данных, исследователи делают вывод, что домашние лошади, завезённые в Анатолию в бронзовом веке, несли мутации, обнаруженные ранее в Северной Евразии и, следовательно, полученные преимущественно от лошадей из этого обширного региона. Хотя окончательное географическое происхождение этой неместной популяции невозможно определить с помощью имеющихся данных, евразийские степи к северу от Чёрного моря кажутся наиболее вероятным кандидатом. Однако местный анатолийский гаплотип P сохранялся у домашних лошадей бронзового века Анатолии и Кавказа, а также у современных лошадей, правда с низкой частотой, около 8%. А это позволяет предположить, что дикие анатолийские лошади, вероятно, часто включались в стада домашних, вскоре после появления их регионе и исчезновения в дикой природе. Результаты свидетельствуют о быстром переходе от охоты к скотоводству после появления домашних лошадей в раннем бронзовом веке, что, вероятно, коррелирует с окончательным сокращением популяции диких лошадей в Анатолии и на Кавказе, на что указывает низкая частота их останков. Схожая картина с двумя гаплотипами Y-хромосомы, Y-HT-1 и Y-HT-3, Анатолии и Кавказа, намекает на возможность популяционной динамики, подобной той, что зафиксирована для Северной Евразии, где преобладающий Y-гаплотип –Y-HT-1 у современных лошадей, заметно увеличился после начала одомашнивания, достигнув фиксации в генофонде к средневековью, в то время как Y-HT-3 снижался с течением времени вплоть до своего исчезновения.

В Анатолийском наборе данных из этой работы оба гаплотипа встречались с сопоставимой частотой около 2000 года до н. э., но и здесь частота Y-HT-3 со временем уменьшилась, а самая последняя лошадь, которая несла Y-HT-3, была родом с Кавказа, возрастом около 3300 лет. Это уменьшение разнообразия Y-хромосом, по-видимому, является результатом сильного отбора жеребцов.

Поскольку северная Евразия, и в частности Причерноморско-Каспийская степь, в настоящее время является наиболее вероятным местом происхождения домашних лошадей, завезённых в Анатолию, существует два возможных маршрута: один через Юго-Восточную Европу и один через Кавказ. Маршрут через Босфор был предложен на основе самых ранних зооархеологических свидетельств существования домашних лошадей на южных Балканах на стоянке раннего бронзового века Канлигечит около 2600–2300 гг. до н. э. Окрасы шерсти 10 лошадей с этого участка были генотипированы и выявили сильно смещённое распределение мутаций окраса шерсти у 6 из 10 гомозиготных черных лошадей, 4 из которых также показывают "пятнистость леопарда" ещё у 2 гнедых лошадей с пятнистостью, мутаций каштанового цвета не обнаружено. Эта картина сильно контрастирует с новыми данными из Анатолии и Кавказа, где каштановый цвет является самым ранним вариантом окраски шерсти, в то время как черные и леопардовые окрасы остаются очень редкими (только 2 из 25).

Эти различия служат аргументом против введения популяции домашних лошадей, аналогичной той, что была обнаружена в Канлигечите. Более того, нет никаких археологических данных о коневодстве в Западной Анатолии в третьем тысячелетии до нашей эры, что не даёт дополнительной поддержки гипотезе о раннем вводном пути через Босфор.

Напротив, новая идентификация нескольких неместных митохондриальных линий и мутаций, связанных с окрасом шерсти, широко появляющихся одновременно на Южном Кавказе и в центральной Анатолии, свидетельствует в пользу пути распространения через Кавказ. Наличие костей и изображений лошадей в поселениях майкопской культуры и погребениях около 3300 г. до н.э. на Северном Кавказе привело к предположению, что практика верховой езды началась в майкопский период. Кроме того, недавние исследования геномов людей того же периода показали непрерывный поток генов между степями медного века и народами Кавказа, а позже, в эпоху бронзы, между Месопотамией, Анатолией, Южным и Северным Кавказом, а также степью. Этот обмен между группами людей, похоже, усиливается с началом похолодания и засухи 4200 лет назад, что могло повлиять на стратегии выживания и социальные сети в степной зоне.

Происхождение домашних лошадей Кавказа и Анатолии прояснила ДНК Наука, Одомашнивание, Приручение, История, Генетика, Длиннопост, Анатолия, Лошади, Зоология, Видео

Согласно имеющимся данным, это климатическое событие, по-видимому, в значительной степени совпало с появлением неместных митохондриальных гаплогрупп и сменой окраса шерсти лошадей на Кавказе и в Анатолии. Что также связано с распространением коневодства и, возможно, индоевропейских языков. Хотя культурные процессы, инициировавшие распространение коневодства к югу от Кавказа, в настоящее время трудно поддаются анализу, они могут быть связаны с перемещением людей через Кавказ в Анатолию, начиная с конца третьего тысячелетия до нашей эры.

Древний мул

Среди образцов из новой работы попался и мул, а именно потомок лошади и осла, из контекста раннего железного века, в Чадир-Хююк Центральной Анатолии, датируемого 1100–800 гг. до н. э. Из данного региона это первое свидетельство мулов, помимо европейского железного века и римского периода. При этом, учитывая, что гаплогруппа кобылы была неместной, получается, что гибрид был от домашних животных. При этом кобыла передала мулу два мутантных аллеля цвета шерсти. Хотя это и не является чем-то удивительным, присутствие мула в железном веке Анатолии отражает новую роль домашних лошадей, появившуюся по мере их распространения в регионе, где домашние ослы использовались с четвёртого тысячелетия до нашей эры. Однако этот случай является ранним примером преднамеренной гибридизации. Будучи самым дорогим видом, упомянутым в ценах на домашний скот хеттского периода от ~ 1600 до ~ 1178 г. до н. э., мулы, вероятно, ценились очень высоко.

Помимо лошадей, результаты нового исследования недвусмысленно свидетельствуют о том, что люди неолита, энеолита и бронзового века Анатолии также охотились на европейских плейстоценовых ослов, которые когда-то населяли большую часть Анатолии. Таким образом, объединённые данные предполагают, что ослы вымерли в Анатолии в эпоху поздней бронзы более или менее одновременно с местными дикими лошадьми, возможно, в ответ на ту же комбинацию факторов, включая повышенную засушливость, связанную с засухой 2100-х годов до н. э., а также конкуренцию за пастбищные ресурсы с растущим количеством скота и, вероятно, из-за охоты элит.

Выводы

В новой работе, охватывающей ~ 9000 лет голоцена, были проанализированы митохондриальные линии древних лошадей из Южного Кавказа и Анатолии. Исследование позволило проверить гипотезу о том, что Анатолия была центром одомашнивания лошадей. Авторам работы удалось идентифицировать митотипы, характерные для местных диких лошадей Анатолии, которые регулярно использовались в раннем и среднем голоцене. При этом генетический анализ показал, что неместные генетические маркеры, которые все ещё присутствуют у домашних лошадей, появились в регионе не постепенно, а внезапно после ~ 2000 г. до н.э. Исследование также демонстрирует, что у этих завезённых домашних лошадей окрас отличался от местных до приручения. Однако материнская линия P, выявленная у местных лошадей до приручения, присутствует и в бронзовом веке, что подразумевает ограниченное включение местных кобыл в домашние стада.

В целом результаты указывают на то, что домашние лошади были завезены в Анатолию, возможно, через Кавказ в период бронзового века, и дают дату начала эксплуатации домашних лошадей в Анатолии и Закавказье около 2000 года до н. э. Данные также свидетельствуют против местного независимого приручения лошади в этом регионе. Новые результаты убедительно указывают на то, что Анатолия не была основным источником происхождения домашних лошадей, но, как наблюдалось и в других регионах, местные материнские линии всё же были включены в стада неместных домашних лошадей, которые также были скрещены с местными ослами для создания мулов. Однако точное географическое происхождение завезённых лошадей ещё предстоит определить.

Источник: Ancient DNA shows domestic horses were introduced in the southern Caucasus and Anatolia during the Bronze Age
Silvia Guimaraes, Benjamin S. Arbuckle, Joris Peters, Sarah E. Adcock, Hijlke Buitenhuis, Hannah Chazin, Ninna Manaseryan, Hans-Peter Uerpmann, Thierry Grange, and Eva-Maria Geigl doi.org/10.1126/sciadv.abb0030
Показать полностью 11
4119

Доступно о генетике

Генетика у обывателей: Ну дед и дядя болели, значит, и ты будешь.

Генетика в школе: Есть два гороха - жёлтый и зелёный.

Генетика в меде: Двойной кроссинговер, AaBBCc vs aaBbCc с кроссинговером в 37%, сучка, экспрессия-репрессия-депрессия-сессия-хуессия, mother fucker!!

Генетика во врачебной практике: Ну дед и дядя болели, значит, и ты будешь.


Доступно о генетике Биология, Генетика, Картинки, ДНК, Юмор
731

Первая в мире искусственная жизнь создана

Крейг Вентер, который десять лет назад первым прочитал геном человека, только что создал первый рукотворный геном и вживил его в клетку. Так человечество перешло от чтения геномов к их написанию.

Ученым впервые удалось создать искусственный геном и заставить живую клетку жить с этим генетическим кодом.

Команда исследователей под руководством Крейга Вентера химическим путем синтезировала геном бактерии Mycoplasma mycoides и вставила его в клетку другого микроорганизма — Mycoplasma capricolum, из которой перед этим были удалены все гены. Полученный «франкенштейн» ожил, стал размножаться и вообще повел себя как обычная бактерия Mycoplasma mycoides. Описание этой замечательной работы опубликовано в четверг в журнале Science.

До сих пор ученые умели только «читать» ДНК живых существ, а вот создать геном de novo (заново) еще никому не удавалось. Получение искусственного организма имеет не только научный интерес, но даже философский: создав жизнеспособное существо с использованием искусственной ДНК, ученые наглядно доказали, что жизнь можно получить из десятка баночек с реактивами. Теоретически этот тезис всем очевиден, но на практике никто никогда его напрямую не подтверждал.

Прежде чем рассказать о деталях незаурядного эксперимента Вентера и коллег, стоит напомнить, кто такой Крейг Вентер. Это своего рода медийная звезда, исследователь, известный не только в биологических кругах, но и широкой публике: впервые его имя зазвучало на рубеже нового тысячелетия, когда вовсю осуществлялся проект «Геном человека» — ученые всего мира коллективными усилиями пытались определить последовательность ДНК Homo sapiens.

Несмотря на все старания, работа продвигалась медленно — проект стартовал в 1990 году, и за девять лет была целиком расшифрована всего одна маленькая хромосома. Вентер и специалисты созданной им компании Celera Genomics усовершенствовали технологии работы с ДНК и подключились к «Геному человека». В 2001 году черновая расшифровка генома была наконец завершена.

На расшифровке генома человека основатель Celera Genomics не остановился — его следующим амбициозным проектом (а Вентера интересуют только амбициозные проекты) стало создание организма с синтетическим геномом.

Казалось бы, ничего сложного здесь нет: надо лишь воссоздать уже известную нам последовательность букв генетического кода и вставить ее в подходящую клетку. Но на самом деле на этом пути исследователи сталкиваются со множеством трудностей — не в последнюю очередь потому, что пока ученые доподлинно не знают всех особенностей работы генома как комплексной системы. Это не просто цепочка букв. Нить ДНК каждого организма снабжена навешанными на нее молекулами-«маячками», так называемыми эпигенетическими маркерами, без которых считывание генома будет проходить некорректно. На то, чтобы научиться вносить в искусственный геном Mycoplasma mycoides необходимые маркеры, у исследователей ушел не один год.

Эксперимент по созданию жизни был спланирован так: ученые синтезируют геном какой-нибудь бактерии (назовем ее бактерией-донором, так как она дает исследователям последовательность своей ДНК) и вставляют его в клетку бактерии другого вида, из которой предварительно удаляют собственный геном (это будет бактерия-реципиент). Если получившийся организм живет, питается и размножается, а также в точности напоминает донорные бактерии, а не бактерии-реципиенты или что-то промежуточное, то эксперимент удался.

В качестве донора ученые выбрали бактерию-паразита Mycoplasma mycoides, отчасти из-за того, что у нее очень маленький геном — всего около миллиона «букв» (для сравнения: в геноме человека их 3 миллиарда). Реципиентом выступала родственная бактерия Mycoplasma capricolum. Самой сложной частью эксперимента был синтез целого бактериального генома: современные технологии не позволяют за раз получать такие длинные цепи. Чтобы преодолеть эту трудность, ученые синтезировали небольшие «кассеты» из ДНК, содержащие только часть генома Mycoplasma mycoides, а затем соединяли их вместе. Пока самым эффективным инструментом для объединения «кассет» являются живые организмы — никакие химические ухищрения не позволяют делать это столь же точно. Исследователи как мозаику складывали геном Mycoplasma mycoides сначала в клетках кишечной палочки, а потом, когда им удалось получить достаточно крупные куски ДНК, в клетках дрожжей.

В итоге им удалось по кусочкам собрать весь геном. «Запихнуть» его в очищенную от ДНК клетку бактерии-реципиента также было нетривиальной задачей.

Полученные бактерии-гибриды выглядели так же, как Mycoplasma mycoides, росли так же, как Mycoplasma mycoides, поглощали питательные вещества так же, как Mycoplasma mycoides, и размножались так же. Чтобы дополнительно убедиться в успехе эксперимента, ученые выделили из гибридных клеток белки, разделили их на фракции и сравнили полученную картину с тем, что получается при выделении белков из обычной Mycoplasma mycoides. Получилось то же самое. Сейчас созданные исследователями бактерии растут в лаборатории и ничем не отличаются от своих соседей из чашки Петри.

Читатель может спросить, а в чем же глубинный смысл экспериментов Вентера? Что дадут человечеству искусственно созданные бактерии?

Авторы статьи объясняют суть своей работы так: отработанная ими технология получения жизнеспособных организмов, геномы которых созданы искусственно, в будущем позволит не только делать копии уже существующих в природе живых существ, как сегодня сделал Вентер, но и создавать абсолютно новые организмы, которые не входили в генеральный план Создателя, или природы, или эволюции — как хотите.

И речь не обязательно идет о каких-то неведомых чудищах: имея на руках работающую методику, можно переписывать генетическую программу привычных организмов таким образом, чтобы они сочетали в себе максимальное число полезных признаков. Можно создать абсолютно новый организм, который, например, одновременно давал бы молоко, синтезировал антибиотики и при этом представлял собой всего лишь культуру клеток в пробирке.

https://snob.ru/selected/entry/18858/
Показать полностью
192

Генетический вариант, повышающий риск тяжелого протекания COVID-19, унаследован от неандертальцев

Генетический вариант, повышающий риск тяжелого протекания COVID-19, унаследован от неандертальцев Наука, Генетика, Палеогенетика, Копипаста, Elementy ru, Коронавирус, Вирус, Неандерталец, Homo sapiens, Длиннопост

Рис. 1. Частота встречаемости неандертальского генетического варианта, повышающего риск тяжелой формы COVID-19. В Африке и Восточной Азии «аллель риска» практически отсутствует, а максимальная частота наблюдается в Южной Азии, особенно в Бангладеш. Рисунок из обсуждаемой статьи в Nature (по данным проекта The 1000 Genomes Project)


На сегодняшний день генетикам удалось выявить только один участок человеческого генома, нуклеотидные вариации в котором значимо влияют на шансы заболеть тяжелой формой COVID-19. Этот фрагмент третьей хромосомы длиной около 50 тысяч пар оснований встречается у современных людей в нескольких вариантах, один из которых повышает шансы попасть в больницу с тяжелой формой COVID-19 примерно в 1,6 раз. Палеогенетики Сванте Пэабо и Хуго Цеберг показали, что этот «аллель риска» имеет неандертальское происхождение. Вместе с другими неандартальскими генами он попал в генофонд внеафриканских сапиенсов в результате гибридизации, которая происходила около 50 тысяч лет назад. Частота встречаемости «аллеля риска» сильно варьирует в зависимости от региона: в Африке и Восточной Азии она близка к нулю, в Европе составляет 8%, в Южной Азии — 30%. Столь большие различия говорят о том, что в не очень далеком прошлом аллель подвергался сильному отбору, иногда положительному, иногда отрицательному. Скорее всего, это связано с тем, что аллель влияет на устойчивость к каким-то другим патогенам помимо нового коронавируса.

Как известно, COVID-19 — болезнь избирательная: кто-то заболевает, кто-то нет, одни переносят легко, другие — тяжело, вплоть до летального исхода. Это зависит от множества негенетических факторов, среди которых особенно важны возраст, пол и наличие определенных заболеваний. Логично предположить, что и генетические различия между людьми тоже вносят свой вклад в наблюдаемый разброс по восприимчивости к COVID-19 и тяжести протекания болезни.

Несмотря на усердные поиски, на сегодняшний день генетикам удалось идентифицировать только один участок человеческого генома, связь которого с риском заполучить тяжелую форму COVID-19 не вызывает никаких сомнений. Этот участок расположен на третьей хромосоме и включает гены SLC6A20, LZTFL1, CCR9, FYCO1, CXCR6 и XCR1. Его влияние на устойчивость к новой инфекции сначала было обнаружено при помощи полногеномного поиска ассоциаций (GWAS) на основе данных по 835 больным и 1255 здоровым итальянцам и 775 больным и 950 здоровым испанцам. Это исследование проводилось во время весеннего пика заболеваемости в Европе (D. Ellinghaus et al., 2020. Genomewide Association Study of Severe Covid-19 with Respiratory Failure).

В дальнейшем результат успешно воспроизвелся в нескольких независимых исследованиях на других европейских и азиатских выборках. Метаанализ, проведенный в рамках проекта COVID-19 Host Genetics Initiative, окончательно подтвердил, что один из вариантов этого участка генома («аллель риска»), характеризующийся определенными нуклеотидами в 13 полиморфных позициях, повышает шансы человека оказаться в больнице с тяжелой формой COVID-19 примерно в 1,6 раз (это несколько упрощенная формулировка, речь идет об отношении шансов, см. Odds ratio, которое, по результатам метаанализа, составляет 1,6 с 95-процентным доверительным интервалом от 1,42 до 1,79). По-видимому, этот генетический вариант повышает и шансы подцепить умеренно тяжелую форму COVID-19 (частота этого варианта выше у людей, госпитализированных с COVID-19, чем в среднем по популяции), и риск очень тяжелого протекания болезни среди уже заболевших (среди госпитализированных пациентов, которым потребовалась искусственная вентиляция легких, частота этого варианта выше, чем у тех, кто обошелся только дополнительным кислородом).

Упомянутые 13 полиморфных позиций разбросаны по участку хромосомы длиной около 50 тысяч пар оснований. При этом нуклеотидные варианты, коррелирующие с повышенным риском тяжелого протекания COVID-19, во всех 13 позициях почти всегда присутствуют все вместе, дружно, образуя единый гаплотип. Иными словами, для них характерно то, что генетики называют «неравновесным сцеплением» (см. Linkage disequilibrium).

Именно такая картина — несколько прочно сцепленных полиморфизмов, расположенных по соседству, — характерна для фрагментов ДНК, полученных предками современных людей от неандертальцев и денисовцев в результате гибридизации.

Поэтому палеогенетики Сванте Пэабо и Хуго Цеберг (Hugo Zeberg) решили проверить, не совпадает ли этот гаплотип с неандертальскими или денисовскими геномными последовательностями. Для этого нужны геномы вымерших видов людей, прочтенные очень качественно, то есть с высоким покрытием. Таких геномов на сегодняшний день четыре: три неандертальских и один денисовский.

Результат получился вполне однозначный: из 13 полиморфизмов, характерных для «гаплотипа риска», 11 присутствуют в гомозиготном состоянии у неандертальца из пещеры Виндия в Хорватии (Vindija 33.19). Три полиморфизма есть у двух других неандертальцев с качественно прочтенными геномами — из Денисовой и Чагырской пещер на Алтае (Denisova 5 и Chagyrskaya 8, см.: Между сапиенсами и неандертальцами существовала частичная репродуктивная изоляция, «Элементы», 03.02.2014; F. Mafessoni et al., 2020. A high-coverage Neandertal genome from Chagyrskaya Cave). В денисовском геноме (см.: Геном денисовского человека отсеквенирован с высокой точностью, «Элементы», 06.09.2012) не оказалось ни одного из 13 полиморфизмов.

Этот результат уже сам по себе является убедительным доводом в пользу того, что «гаплотип риска» унаследован современными людьми от неандертальцев, близких к индивиду из пещеры Виндия. Остальные неандертальские примеси в современных геномах тоже ближе к геному хорватского неандертальца, чем к индивидам с Алтая. Объясняется это тем, что те неандертальцы, с которыми скрещивались вышедшие из Африки сапиенсы 60–50 тысяч лет назад, были более близкой родней хорватского неандертальца, чем алтайских.

Дополнительные тесты подтвердили вывод о неандертальском происхождении «гаплотипа риска». В частности, вероятность того, что такой длинный гаплотип мог быть унаследован хорватским неандертальцем и современными людьми от общего предка, оказалась, по расчетам авторов, пренебрежимо низкой. За более чем полмиллиона лет раздельного существования сапиенсов и неандертальцев гаплотип должен был бы покрошиться на мелкие кусочки из-за кроссинговера. Авторы также построили филогенетическое дерево для всех имеющихся у современных людей вариантов (аллелей) рассматриваемого участка генома. На этом дереве все современные аллели, связанные с повышенным риском тяжелой формы COVID-19 (они отличаются друг от друга лишь единичными нуклеотидными заменами), образовали единую компактную ветвь с хорватским неандертальцем, а сестринскими к этой ветви оказались неандертальские варианты с Алтая. Иными словами, «аллель риска» (во всех его незначительных вариациях) ближе к любому из трех неандертальских вариантов, чем к любому другому варианту этого участка генома, встречающемуся у современных людей. Таким образом, неандертальское происхождение «гаплотипа риска» доказано вполне надежно.

Частота встречаемости неандертальского «гаплотипа риска» в современных человеческих популяциях сильно варьирует в зависимости от региона (рис. 1). Его практически нет в Африке, что логично, поскольку приток неандертальских генов в генофонд современных африканцев, живущих к югу от Сахары, был незначительным (и, вероятно, непрямым). Почти нет его и у жителей Восточной Азии (китайцев, японцев). Это неожиданный результат, потому что других неандертальских генов у восточноазиатов немало — даже чуть больше, чем у европейцев. В Европе неандертальский гаплотип встречается с частотой около 8%, в Южной Азии — 30%. Наибольшая частота характерна для Бангладеш: 63% жителей этой страны несут по крайней мере одну копию неандертальского гаплотипа, а 13% — две копии (то есть являются гомозиготами), что дает общую частоту 13 + (63 − 13)/2 = 38%. Это согласуется с тем, что в Великобритании, по официальным данным, шансы умереть от COVID-19 у выходцев из Бангладеш примерно вдвое (95% доверительный интервал: 1,7–2,4) выше, чем у белых британцев. У выходцев из других стран ситуация заметно лучше, чем у бангладешцев.

Объяснить, почему в Восточной Азии частота встречаемости неандертальского гаплотипа почти нулевая, а в Южной — очень высокая, по-видимому, можно только сильным отбором, который действовал по-разному в разных регионах. Логично предположить, что главным фактором отбора были какие-то патогены. Может быть, неандертальский гаплотип, снижающий сопротивляемость новой короновирусной инфекции, подвергался отрицательному отбору в Китае во время каких-то прежних эпидемий, вызванных другими коронавирусами, а в дельте Ганга на него действовал положительный отбор, потому что он обеспечивал защиту от каких-то других патогенов. Но пока все это — только домыслы, потому что неизвестно, какие именно особенности неандертальского гаплотипа ответственны за повышенный риск тяжелого протекания COVID-19 и каков механизм их действия. Как уже говорилось, в состав гаплотипа входит шесть генов, среди которых не удается однозначно определить кандидата на роль главного фактора риска. Им может оказаться, например, ген SLC6A20, потому что белок, кодируемый этим геном, взаимодействует с белком ACE2 — «входными воротами» нового коронавируса. Не сняты подозрения и с генов CCR9 и CXCR6, потому что они кодируют рецепторы хемокинов, причем работа второго из них имеет прямое отношение к иммунным процессам в легких, например, при гриппе.

Когда-нибудь, возможно, мы узнаем, от каких патогенов защищал этот гаплотип неандертальцев (а также предков нынешнего населения Южной Азии), но пока фантазировать об этом рано. Одно можно сказать наверняка: в 2020 году с некоторыми нашими современниками неандертальское наследие сыграло злую шутку.


Источник: Hugo Zeberg & Svante Pääbo. The major genetic risk factor for severe COVID-19 is inherited from Neanderthals // Nature. 2020. DOI: 10.1038/s41586-020-2818-3.


См. также: Неандертальские гены влияют на здоровье современных людей, «Элементы», 20.02.2016.


Александр Марков


https://elementy.ru/novosti_nauki/433709/Geneticheskiy_varia...
Показать полностью
108

Откуда в Красной армии мода на "гитлеровские" усишки?

Если Вы интересуетесь историей Великой Отечественной войны, то наверняка замечали, что у многих командиров Красной армии над верхней губой красуются маленькие усишки, аналогичные растительности на лице фюрера.

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Что это было? Не пародия же на злейшего врага! Проявление моды? Или был у таких усов некий практический смысл? Давайте разбираться вместе...


Задолго до фюрера...


Прежде всего следует вспомнить, что отнюдь не Гитлер стал "законодателем мод" и первым обладателем "компактных" усишек.

Принято считать, что мода на подобную растительность появилась еще в конце XIX века, в среде европейских и американских рабочих. Усы "щеточкой", как их принято называть оказались золотой серединой между желанием подчеркнуть мужественность и нежеланием "заморачиваться" с уходом за растительностью. Которая к тому же, может мешать в повседневной жизни.
Мали ли куда могут угодить принадлежащие работяге роскошные усы в стиле Буденного или пышная борода? Хорошо, если просто в масло или прочие субстанции... А ну как где-нибудь в литейном цеху загорятся? Или на что-нибудь их намотает? Короче говоря, травматизЬм подстерегает повсюду))) А с усами-щеточкой таких проблем нет...
И, разумеется, форма усов приживается, получая распространение не только среди рабочих.
Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Эдгар Аллан По (1809 - 1849 год). Тоже "щеточка", разве что чуть шире классической.

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Чарли Чаплин, выглядевший без усов вполне серьезным мужчиной, сделал их атрибутом комического образа...

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Джордж Оруэлл (1903-1950)


Так что в Красной армии сия форма усов появилась не из воздуха, и уж точно без какой-либо связи с Гитлером...


Масштабы явления...


Глядя на фото представителей командного состава РККА, можно вообразить, будто усатый Сталин и усатый же Буденный оказывали протекцию командирам с этой формой растительности на лице)))

И товарищей с "щеточкой" среди генералитета немало. Судите сами...

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Климент Ефремович Ворошилов - маршал СССР, нарком обороны, дважды Герой Советского Союза, Герой Социалистического Труда. Легендарная фигура, что и говорить! В честь кого попало тяжелые танки не называют)))

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Григорий Иванович Кулик, маршал, Герой Советского Союза...

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Леонид Александрович Говоров - маршал, Герой Советского Союза. Вошел в историю как освободитель Ленинграда.

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Иван Владимирович Тюленев - генерал, Герой Советского Союза. С началом войны командовал Южным фронтом.

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Иван Васильевич Панфилов - генерал-майор, Герой Советского Союза посмертно. Командир легендарной 316 стрелковой дивизии, героически сражавшейся на подступах к Москве...


Вот далеко не полный список носителей усов-щеток, если угодно, щетконосцев))) Аналогичную растительность "разводил" под носом Генрих Ягода - нарком внутренних дел, мрачный "инквизитор" Сталина. "Щеточка" отличала и выдающегося советского поэта, военного корреспондента, драматурга и киносценариста Константина Михайловича Симонова...


Поправьте меня, если ошибаюсь (не скажу, что активно выискивал), но по-моему, в рядах генералитета нацистской Германии сия форма усов была далеко не так популярна. Кроме гнусной физиономии Гиммлера и Гудериана, пожалуй, никто на ум и не приходит...


Почему именно эта форма усов...


Действительно, носили бы залихватские усы в стиле Буденного))) Или чуть более скромные сталинские)))

Такому странному выбору, на мой взгляд есть причины...

Во-первых, военному человеку желательно иметь минимум растительности на голове (неспроста же в армии всегда брили и бреют головы солдатушкам). Из чисто санитарных соображений - в случае войны ухаживать за растительностью станет затруднительно. Заведутся вши, а за ними армию начнет косить сыпной тиф! Нежелательный сценарий...

Откуда в Красной армии мода на "гитлеровские" усишки? История, Наука, Факты, Вторая мировая война, СССР, Усы, Великая отечественная война, Длиннопост

Пока еще с обычными усами Гитлер в годы Первой мировой войны...


На просторах рунета витает версия, что усы щеточкой Гитлер носил из-за того, что в годы ПМВ длинные усы мешали надевать противогаз. Честно говоря, на этот счет у меня есть сомнения. Пышная борода действительно могла бы погубить своего владельца, если из-за нее противогаз будет недостаточно плотно прилегать к лицу, и солдат надышится каким-нибудь хлором или фосгеном... А усы-то тут причем)))


Есть у меня еще предположение (доказывать его в серьезной дискуссии не готов, но звучит красиво) - мол, если "щеточка" изначально - усы рабочего, то красные командиры таким образом подчеркивали свою принадлежность к пролетариату и преданность делу революции! Во всяком случае, среди сталинского окружения "старорежимных" бород было не так уж и много)))


Разве что выгнанный из страны Троцкий, расстрелянный в 1936 году Каменев, расстрелянный в 1938 году Бухарин... Боже мой!!! В ВКП(б) шла внутрипартийная борьба между усачами и бородачами)))

Так, все... Пора заканчивать статью, пока еще какая-нибудь конспирологическая теория не всплыла))) Спасибо за внимание!

Показать полностью 9
5911

Новость №1101: Международная комиссия по клиническому применению генетического редактирования разрешила генетически редактировать детей

Новость №1101: Международная комиссия по клиническому применению генетического редактирования разрешила генетически редактировать детей Образовач, Комиксы, Наука, Генетика, Трансгуманизм, Геном, Редактирование генома

https://nplus1.ru/material/2020/09/23/whoedits

98

Как укладка ДНК в клетке может вызывать наследственные болезни

В последние годы в генетике сформировался новый взгляд на геном: не просто цепочка генов, а трехмерная сеть, архитектура которой играет важную роль в реализации информации, заложенной в ДНК. Изучением и моделированием того, как молекула ДНК располагается внутри клеточного ядра и как это влияет на вероятность развития ряда наследственных заболеваний, занимаются сотрудники сектора геномных механизмов онтогенеза ФИЦ ИЦиГ СО РАН. Ряд результатов их работы был представлен на XII международной мультиконференции «Биоинформатика и системная биология» (BGRS/SB-2020). Подробности об этой работе в нашем интервью с руководителем сектора, к.б.н. Вениамином Фишманом.

Как укладка ДНК в клетке может вызывать наследственные болезни Академгородок, ДНК, Генетика, Наследственные болезни, Копипаста, Длиннопост

– Расскажите, в чем заключается цель проводимых Вашей группой исследований 3D-моделей генома человека?

– Когда в геноме возникает какая-то поломка, мутация, которая ведет к развитию патологии, возникает вопрос – по какому пути протекает этот процесс. Если мутация затрагивает какие-то кодирующие участки ДНК, отвечающие за синтез белка, то все, в принципе, очевидно: вот причина, а вот – ее следствие. Но когда мы имеем дело с какими-то крупными перестройками, которые не затронули белок-кодирующие гены, все становится намного сложнее. Потому что не ясно, если все белки остались те же самые, то что вызвало болезнь? Так родилась гипотеза, которая потом была подтверждена в ряде работ разных исследователей, что само изменение 3D-организации генома (то, как цепочка ДНК укладывается в ядре клетки) влияет на работу генов и количество того или иного белка, который синтезируется в клетке. Отсюда и вытекает наша цель – смоделировать, как уложен геном в известных случаях хромосомных перестроек и, следующий шаг, понять, как это влияет на работу генов и синтез белка.

– Как Вы строите эти модели?

– Есть два класса моделей. Физические модели удобны тем, что в них можно заложить какие-то биофизические параметры. Например, в такой модели ДНК может гнуться, протягиваться. Причем, все это обусловлено довольно простыми физическими законами, которые изучают в рамках школьной программы. Проблема в том, что есть очень много биофизических параметров, которые надо учитывать при создании модели: насколько легко изгибать ДНК, насколько сильно воздействие электростатического отталкивания и так далее. Но их очень сложно измерить, поскольку сама ДНК находится глубоко в ядре клетки, там все организовано не так, как мы можем воссоздать, условно говоря, «в пробирке». Поэтому физические модели замечательны с точки зрения понимания каких-то механизмов, но часто неприменимы для реальных задач, поскольку мы не можем создать полную картину для какого-то конкретного варианта мутаций, только описать общие принципы связи архитектуры генома и его работы.

– Есть какой-то выход?

– Конечно. В своей работе мы чаще используем второй тип моделей, построенных методом «черного ящика». В его основе лежит машинное обучение: мы измеряем в эксперименте те свойства ДНК, которые можем, и загружаем их в компьютер. А дальше машина сама находит взаимосвязи между известными нам параметрами и разными вариантами укладки ДНК, которых тоже известно немало. Конечно, мы не можем таким образом понять, как именно последовательности на разных участках генома связаны с физическими свойствами ДНК. Физики их тестируют, но у них в среднем на одну такую взаимосвязь уходит года три, а их существует множество. То есть, это работа на века, по крайней мере, при нынешних темпах развития науки. Поэтому пока мы просто ищем такие взаимосвязи, фиксируем результат, пусть даже не понимая до конца, почему он получился именно таким. И для этого метод «черного ящика» очень хорошо подходит, потому что он выдает очень точные ответы с точки зрения практики.

– То есть, Вы видите, что получилось, пусть не всегда понимая, почему именно так, а не иначе?

– Можно сказать и так, хотя есть и какие-то взаимосвязи, которые мы можем понять. Например, поменять одну букву в последовательности ДНК и посмотреть, как наш черный ящик в ответ изменит укладку. Да, полная цепочка событий нам по-прежнему неизвестна, но мы можем с уверенностью говорить, какие участки ДНК более важны, какие – менее в данном сценарии. А потом, рассмотрев биологические функции этих участков, сформулировать гипотезу о том, как они вовлечены в этот сценарий. И уже на основе этого – переходить к созданию физической модели. Но все же, мне кажется, основная прелесть моделей второго типа как раз в том, что они дают достаточно точный результат, даже когда мы не изучили сам механизм его получения.

– Вы сейчас говорите о прогнозе развития у человека какой-то конкретной наследственной патологии?

– Совершенно верно, но не только об этом. Есть еще одно направление, я называю его методическим. Мы говорим о довольно сложных вещах: 3D-укладка генома, белки садятся, ДНК гнется, все это имеет сложную систему связей. Но есть очень простой вывод, когда случается хромосомная перестройка, меняется укладка, и по этим изменениям можно предсказывать риск развития наследственного заболевания. Причем, это недавняя история, еще несколько лет назад никто не смотрел на организацию ДНК у таких людей, просто искали изменения в линейной последовательности. Теперь же, в силу прогресса способов исследования ДНК, подход вообще можно кардинально развернуть: предсказать эти линейные перестройки на основе информации о том, как ДНК уложена в ядре. Это, по сути, новый метод изучения наследственных заболеваний, который мы сейчас тоже развиваем. Конечно, мы не одни, и даже – не первые, такие идеи бродят года с 2012-го. Но, обычно, стараются предсказывать на основе укладки крупные перестройки, а мы разрабатываем метод, который, при определенных изменениях протокола, позволит посмотреть и на точечные полиморфизмы. А это совсем другой диагностический подход. Раньше совместить оба подхода в рамках одного метода никому особо не удавалось, изучали либо крупные перестройки, либо искали точечные мутации. Это проблема, потому что пациенту надо, по-хорошему, делать два дорогостоящих анализа. И часто, если во время первого анализа что-то находили, то второй просто не делали, а может, основная причина была как раз там. Если у нас получится совместить оба подхода в рамках одного анализа, это будет очень важно. Предварительные результаты, которые мы представили на конференции BGRS/SB-2020, внушают оптимизм.

– А с точки зрения пациента, какая от этого польза? Ведь если причина болезни в мутации ДНК, то современная медицина все равно не сможет ее вылечить.

– Для пациента есть два важных нюанса. Первый – дать родителям возможность понять, какой из вариантов генома приводит или может привести к появлению заболевания у их детей. Можно определит, от кого из родителей ребенку достался этот вариант. И если родители прибегнут к процедуре ЭКО, можно, используя наш метод, выбрать эмбрион без «плохой» мутации в геноме. Проще говоря, родить здорового ребенка. Второй нюанс относится к людям, которые уже родились с каким-то наследственным заболеванием. К сожалению, такие болезни пока не поддаются полноценному лечению, но, зная на раннем этапе о мутации, которая вызывает заболевание, в ряде случаев можно предложить стратегии его сдерживания, поддержания более комфортного уровня жизни. А там, где это пока невозможно, даже сам точный прогноз, как и в какие сроки все будет протекать – как мне кажется, нужная для родителей вещь. Потому что такое случается, и родителям важно понимать, что их ждет и что дальше делать.

Источник

Показать полностью
81

Происхождение цыган (генетическая история европейских цыган)

Цыгане — это преимущественно кочующая индоарийская этническая группа, без собственной письменной истории, однако за 15 веков распространившаяся, по обширным территориям. Наибольшее их количество сосредоточено в регионах Восточной и Центральной Европы, но они в большом количестве живут на Пиренейском полуострове, а также на Кавказе, Ближнем Востоке и в Америке. Точное количество цыган трудно оценить из-за отсутствия надежных методов переписи, поэтому в разных источниках данные варьируются от 4 до 15 млн. человек. Сразу отмечу, что у описываемых групп людей есть различные самоназвания, да и разные народы их также называли по-разному. Также акцентирую внимание на том, что речь в данном видео преимущественно о европейских популяциях цыган. Почти не касаясь цыган – дом, лом, люли и других.

Сравнительная лингвистика помещает родину европейских цыган в Индии, особенно в северо-западном регионе, поскольку цыганский язык тесно связан с пенджабским и кашмирским. Однако социальная организация и культурная динамика в индийских популяциях такова, что люди, проживающие в тесно связанных языковых группах и даже в одном и том же регионе, имеют разные пропорции генетических компонентов, связанных с предками южных и северных индийцев. Что не позволяет рассматривать их как генетически однородные группы и затрудняет поиск происхождения цыган, основанный исключительно на лингвистических данных.

Индийская генетическая составляющая цыганской популяции была впервые предложена после выявления общих болезнетворных мутаций у индийских и пакистанских пациентов. Анализ однополых маркеров позволил установить индийское происхождение некоторых материнских и отцовских линий, обнаруженных у цыган. Это относится к линиям М5, М18, М25, М35, митохондриальной гаплогруппы M и к линии М69 гаплогруппы Y-хромосомы Н.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Кроме того, общегеномные исследования показывают, что европейские цыгане происходят от уменьшенного числа популяции-основателей или протоцыган, прародиной которых был нынешний штат Пенджаб на северо-западе Индии.

Согласно предыдущим историческим и антропологическим свидетельствам, предковые популяции цыган мигрировали из Северо-Западной Индии на Балканский полуостров, через Персию, Армению и Малоазиатское нагорье, примерно в IX-X веке нашей эры. А в XI-XII веке некоторые цыгане расселились по Балканскому полуострову, образовав соответственно балканских цыган. Другие группы распространились по Дунайским княжествам (современная Румыния, Молдова и Венгрия), где их принудили к рабству, так получились цыгане-влахи.

Под влахами (Vlax Roma) в данном случае подразумеваются группы цыган, говорящие на влашских диалектах цыганского языка

А группы будущих карпатских цыган или ромунгров, рассеялись по всей Австро-Венгерской империи. И наконец, другие небольшие группы переселились в Северную, Центральную и Западную Европу (северо-западные цыгане). Прибытие цыган на Пиренейский полуостров в начале XV века, подтверждается рядом иберийских исторических записей, упоминающих о присутствии цыганских групп в Сарагосе и Барселоне в 1425 и 1447 годах соответственно.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Выше описана довольно упрощённая модель, а в целом распространение цыган по Ближнему Востоку, Кавказу и Европе было очень сложным процессом, в ходе которого цыганские популяции получали существенные потоки генов из различных европейских, ближневосточных и кавказских, нецыганских популяций. Помимо этого, обмен генами происходил и между генетически отличающимися популяциями цыган. Общегеномные данные показали, что у цыган до 80% западноевразийских предков (с учётом популяций Ближнего Востока и Кавказа), в то время как остальные 20% происходят из южноазиатских источников. Однако здесь стоит учитывать, что часть западноевразийского компонента, до 15%, уже присутствовала в Южной Азии задолго до формирования прото-цыганских популяций, ещё около 4 тыс. лет назад в виде предков северных индийцев. Более подробно описано в ролике: Популяционная история Центральной и Южной Азии по данным древней ДНК.

Также хочу обратить внимание зрителей, на то, как генетически изменялись популяции цыган всего за полторы тысячи лет, несмотря на практики заключения браков в пределах своей группы. Ведь в итоге цыгане состоят из разнородной и субструктурированной мозаики популяций, которые демонстрируют культурно-исторические и лингвистические различия не только с соседними популяциями, но и между собой. Это может быть хорошим примером, для некоторых людей, представляющих популяции с эндогамными социальными практиками, как что-то единое и неизменное в генетическом плане на протяжении тысяч лет. Это любителям великих предков на заметку.

При этом эндогамия приводит к различному спектру наследственных заболеваний, что и отмечено у цыган, по сравнению с другими популяциями. Поскольку географически рассредоточенное кочевое население было социально изолировано, а также часто подвергалось преследованиям начиная со Средневековья и до наших дней.

Исторические записи подтверждают преследование и социальную маргинализацию, которой подвергались популяции цыган с момента прибытия в Европу. Также предпринимались попытки их насильственной ассимиляции, например, в Габсбургской монархии или Норвегии с XVIII по XX века, а также в СССР.


Структура популяции цыган


Образцы цыган из разных исследований, на графике анализа главных компонент расположились между европейцами и популяциями Южной Азии, в соответствии с их южноазиатским происхождением и последующем смешением с европейцами.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Анализ примесей показал два основных компонента предков: западноевразийский и южноазиатский, что еще раз подтверждает южноазиатское происхождение цыган и недавнюю европейскую примесь.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

А при сравнении цыганских групп между собой, исследователи обнаружили четкое разделение между северными и западными группами, испанскими и прибалтийскими цыганами, а также между северо-западными цыганами и другими группами.

Также не обошлось и без сюрпризов для добровольцев, у одного представителя влахов из Венгрии вообще не обнаружилось цыганской родословной, после чего этот образец ДНК был удален из последующих анализов.

Кстати, вопрос: кем считать этого человека, если он сам считает себя цыганом?


Формирование цыганских популяций и источники примеси


После того, как популяции прото-цыган покинули территорию Индию были зафиксированы события примеси с европейскими популяциями около 1270–1580 гг. Этот интервал дат вписывается в периоды, когда появляются первые исторические записи о цыган в странах Европы. Более ранние даты примеси из Балканского полуострова и Центральной Европы, они указывают на то, что расселение цыган по Европе происходило через Балканы. В результате примеси с популяциями по пути следования, у цыган от южноазиатского источника осталось только около 35%. При этом по распределению аллелей этот источник схож с пенджабцами из северо-западной Индии и не только, так как пенджабцы генетически неоднородны и не группируются вместе в связи со сложной и неоднородной структурой населения в Индии с различными пропорциями предков южных и северных индийцев. Но большая часть южноазиатского происхождения цыган в основном принадлежит группе лиц из Пенджаба с меньшим западноевразийским компонентом. Также отмечен вклад и от популяций говорящие на дравидийских языках, как народ ирула, к примеру, представители которого также демонстрируют низкие уровни западноевразийского происхождения.

Стоит отметить, что большая схожесть цыган с современными популяциями Пакистана, чем с Северо-Западной Индией, обусловлена потоком европейских генов на эту территорию уже после того, как прото-цыгане покинули Индию. Это также стоит учитывать.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

В целом, эти данные позволяют предположить, что наиболее вероятным представителем южноазиатского происхождения прото-цыган является наследственный источник, описанный как смесь современных южно-азиатских групп с низким западно-евразийским вкладом. Анализ идентичности по происхождению, также указал на Пенджаб как предполагаемый регион происхождения предков цыган в пределах Индийского субконтинента. При этом формирование цыганского населения, происходило как единое событие.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

А среди популяций, которые внесли наибольший свой вклад в генофонд цыган по ходу их движения в сторону Европы, были армяне, а затем турки. При этом, после прибытия цыган в Европу, дальнейших примесей с представителями Ближнего Востока и Кавказа не наблюдалось.

Что касается европейского вклада, то нет никаких свидетельств того, что какие-то отдельные популяции являются источником потока генов в конкретную группу цыган, хотя юго-западные и юго-восточные европейцы, по-видимому, вносят больший вклад. В цыганских группах Балкан и Центральной Европы европейская примесь составляет около 60%, и увеличивается до 80% по мере удаления от Балканского полуострова. Северные и западные цыгане, включают наибольшее количество европейского происхождения. У цыган, мигрировавших в Северную и Юго-Западную Европу, балканский компонент оставил отличительный след, хотя он был сильно переконфигурирован примесью в Балтийском регионе и на Пиренейском полуострове. Демографическая модель предполагает несколько событий генетических расколов в цыганских популяциях. После отделения их от индийских популяций около 1600-2000 лет назад, первый раскол произошел уже на Балканском полуострове между предками балканских цыган и влахов, и группами мигрантов за пределами Балкан (общими предками карпатских и северо-западных цыган). Два более поздних раскола произошли между карпатскими и северо-западными цыганами, а также между балканскими цыганами и влахами.


Изменение эффективного размера популяции цыган на протяжении поколений


Анализируя все группы цыган вместе, исследователи обнаружили, что эффективный размер предковой популяции цыган перекрывался с таковым у северных индийцев, примерно, до 125 поколений назад, в соответствии с происхождением цыган в этом регионе. Однако в последующие годы эффективный размер популяции предков цыган постоянно сокращался и начал отличаться от эффективного размера популяции Северной Индии. При этом группы северных и южных индийцев не продемонстрировали столь резкого сокращения численности населения. Расчёт показал, что минимальный эффективный размер популяции цыган между 1159 и 1333 годом н. э., составлял 871 - 1160 человек, после чего эффективный размер немного увеличился и снова уменьшился в последних поколениях до наших дней.

Но между 570 и 1005 гг. н. э., когда группы цыган покидали Индию, их эффективный размер популяции составлял от 1380 до 6120 человек.


Оценки эндогамии


Цыгане демонстрируют более высокие показатели эндогамии, чем европейцы или северные индийцы, даже невзирая на то, что они сильно смешаны с европейцами.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Степень генетической однородности в геномах цыган сопоставима с популяциями Южной Индии, которые, как известно, следуют культурным традициям по заключению браков между близкими родственниками. Вероятно, что и у цыган браки заключались преимущественно в пределах определённой социальной группы. Также у цыган отчетливо прослеживается эффект основателя или снижение и смещение генетического разнообразия, а также отмечены последующие, так называемые узкие места в виде сокращения генофонда, которые цыгане переживали в своей демографической истории. Единственными двумя группами, которые демонстрируют более высокие показатели эндогамии и инбридинга, чем у цыган, были южноиндийские популяции ирула и веллалар, говорящие на дравидийских языках. А между группами европейских цыган, балканские цыган показали меньшую степень гомозиготности, чем остальные группы цыган. Это может быть объяснено большей численностью цыган в местах, через которые они попали в Европу, а последующие мигранты, испытывали снижение численности популяции после отделения от балканских цыган. А теперь перейдём к последствиям эндогамии.


Наследственные заболевания у цыган


Высокий уровень эндогамии, присутствующий в геноме цыган, возможно, увеличил вероятность переноса вредных мутаций и аллелей. Проще говоря, увеличились риски наследственных заболеваний. Из 48 известных вариантов мутаций, связанных с такими заболеваниями, 11 было обнаружено только у 40 добровольцев из последней работы. При этом 9 вариантов имели европейское происхождение, указывая на основную европейскую составляющую, а два на южноазиатскую. Среди южноазиатских, один вариант rs121918355, связан с первичной врожденной глаукомой. А второй вариант rs104894396, ассоциирован с множеством заболеваний, связанных с потерей слуха и глухотой.

Хочу обратить внимание на этот раздел комментаторов, которые всеми средствами защищают эндогамию в своём обществе, под предлогом: "зато мы знаем своих предков". Посмотрите какой ценой может обойтись иллюзия знания.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Ведь как показывает практика, даже при высоком уровне эндогамии, от генетического состава образующей популяции, может остаться только 20%... И вряд ли представители этих популяций знают кем были эти 80%, Но также нужно понимать, что у разных популяций и условия развития отличаются...


Предпочтения в смешении


Как уже упоминалось, у европейских цыган обнаружено два источника предков: западно-евразийский, включающий европейские, ближневосточные и кавказские популяции, а также южноазиатский, близкий к пенджабцам. При сравнении пропорций предков в Х-хромосомах и аутосомах можно определить какого пола представители вносили больше своего вклада в цыган. По результатам выяснилось, что мужчинам Ближнего Востока и Кавказа нецыганского происхождения, очень приглянулись цыганки. Да и в целом больший вклад нецыганского происхождения у цыган принадлежит мужчинам. Хотя в меньшей степени к цыганам присоединялись и женщины из мест, где они проходили. А среди европейских популяций, наиболее полюбивших цыганок, оказались мужчины Пиренейского полуострова, Прибалтики и Восточной Европы.


Заключение


Демографическая история цыган характеризуется серией узких мест, до 44% от первоначальной численности популяции и примесей до 80%, которые начали происходить, когда прото-цыгане покинули Индию, и продолжались после их прибытия на Балканы, а позже, и в результате расселения по Европе. Примечательно, что сильная примесь у цыган не стерла признаков того, что цыгане испытали сильное сокращение генофонда в начале расселения. Однако эта западноевразийская примесь частично компенсировала предыдущую утрату генетического разнообразия цыган.

Изучение генетического профиля цыган в мировом контексте ставит их между южными азиатами и европейцами, причём ближе к европейцам, что подтверждается и предыдущими данными о примесях. А предки цыган происходят из региона Пенджаб в северо-западной части Индийского субконтинента, несмотря на обнаруженную неоднородность населения в этом регионе, что согласуется и с лингвистическими данными. По разным оценкам, прото-цыгане отделились от населения, говорящего на пенджаби от 2 до 1,5 тыс. лет назад, и позже покинули Индию, через несколько поколений, когда генетически уже стали отличаться от пенджабцев.

Интересно, что несмотря на то, что цыгане считаются изолированной популяцией с частыми случаями сокращения генофонда, расщеплениями и эндогамией, они всё же являются сильно смешанной популяцией со второй родиной на Балканском полуострове, если говорить упрощённо.

Происхождение цыган (генетическая история европейских цыган) Наука, Популяционная генетика, Цыгане, История, Генетика, Видео, Длиннопост, Гифка

Источники:

1. Erica Bianco, Guillaume Laval, Neus Font-Porterias, Carla García-Fernandez, Begoña Dobon, Rubén Sabido-Vera, Emilija Sukarova Stefanovska, Vaidutis Kučinskas, Halyna Makukh, Horolma Pamjav, Lluis Quintana-Murci, Mihai G Netea, Jaume Bertranpetit, Francesc Calafell, David Comas, Recent common origin, reduced population size, and marked admixture have shaped European Roma genomes, Molecular Biology and Evolution, , msaa156, doi.org/10.1093/molbev/msaa156
2. Font-Porterias N, Arauna LR, Poveda A, Bianco E, Rebato E, Prata MJ, et al. (2019) European Roma groups show complex West Eurasian admixture footprints and a common South Asian genetic origin. PLoS Genet 15(9): e1008417. doi.org/10.1371/journal.pgen.1008417
Показать полностью 9
239

Анализ ДНК подтвердил теорию Тура Хейердала

Американским ученым из Стэнфордского университета удалось доказать гипотезу, предусматривающую тот факт, что древние обитатели американского континента совершали путешествия на острова Полинезии

Специалисты получили генетический материал от 807 жителей Французской Полинезии и Колумбии. Образцы генома распространились на пятнадцать индейских групп и семнадцать островов. Эти люди проживают на Тихоокеанском побережье Южной и Северной Америки.

Ученые провели анализы и выяснили, что фрагменты ДНК островитян и индейских групп одинаковы. А это в свою очередь говорит о смешивании культур


"Мы обнаружили идентичные по происхождению сегменты ДНК индейских предков на нескольких Полинезийских островах. Это убедительно доказывает, что было одно общее контактное событие"

Исследователи полагают, что народы могли встретиться приблизительно в 1200-х годах н.э., в период, когда происходило заселение Полинезийских островов. Они считают, что полинезийцы присутствовали в современной Колумбии. Существует вероятность, что индейцы случайным образом на кораблях прибыли на острова.


Возможные контакты между этими регионами были предметом научных споров в течение нескольких десятилетий. Так, в 1947 году норвежский исследователь Тур Хейердал совершил путешествие на плоту из Южной Америки в Полинезию, чтобы продемонстрировать, что подобное было возможно для древних племен

Анализ ДНК подтвердил теорию Тура Хейердала Тур Хейердал, Наука, Исследования, Кон-Тики, Длиннопост, Генетика

Экспедиция на бальсовом плоту "Кон-Тики" в 1947 году


Многие эксперты предполагали, что эти две популяции смешались еще до прибытия европейцев в Южную Америку, хотя между ними пролегали тысячи километров открытого океана. Но прямых доказательств до последнего времени не было.


Предыдущие генетические исследования были посвящены в основном населению острова Пасхи, известного своими гигантскими каменными статуями (моаи), поскольку географически он ближе остальных к материку. Но на самом деле первый контакт, скорее всего, произошел на одном из архипелагов Восточной Полинезии, как и предполагал Хейердал.

Больше об исследовании в статье Генетический анализ показал, что первыми Америку открыли полинезийцы. Достижениями экспедиции Тура Хейердала, как мы помним, помимо доказательства возможности пересечения Тихого океана (Тур, правда, плыл в обратном направлении - из Перу в Полинезию), было невозможность занесения случайным образом тех же кокосовых пальм из Южной Америки на о.Полинезии (сами кокосы в морской воде не сохранялись, а значит уже опровергается мысль о том, что они каким-либо образом приплыли сами), что также говорит о контактах коренных жителей Южной Америки и Французской Полинезии

Анализ ДНК подтвердил теорию Тура Хейердала Тур Хейердал, Наука, Исследования, Кон-Тики, Длиннопост, Генетика
Показать полностью 1
714

Оживший труп

Оживший труп Телегония, Генетика, Наука, Суеверия, Невежество, Длиннопост

"Голову кладя на плаху и выпив мирное вино,

Я правду расскажу про Спарту и про Афины заодно"

(Л.Фейхтвангер)


На одном вполне уважаемом и посещаемом ресурсе вдруг появилась статья о телегонии. Что это полная чепуха, ясно уже школьникам, по крайней мере, не слишком злостно прогуливавшим уроки биологии. Поэтому меня удивило обсуждение того опуса. Вроде бы взрослые, как бы образованные люди пустились в такие рассуждения, что я счел своим долгом возопить, как тот ксендз у Ильфа и Петрова : «Доконд пан идзе?! Опомятайсе, пан!».

Дискуссия привела к тому, что бедная моя голова пошла кругом, и я погрузился в интернет в надежде выудить понимание ситуации на «настоящий момент».

Всплыло нечто такое:

"Законы РИТА запрещают межрасовые браки славянских народов с негроидными, монголоидными, еврееидными. Смешение Крови выше перечисленный народов между собой приводит к деградации, заболеванию крови (СПИД), вырождению всей ветви данного Рода.

Здоровая наследственность нашими предками сохранялась благодаря девственной чистоте невесты, от гулящей девушки хорошего потомства не получишь. Нравственно падшую девушку считали испорченной, не достойной замужества. Когда юноша брал в жёны "порченую" девушку, такое воссоединение называли "браком", а не Семейным Союзом.

Люди Родов Расы Великой должны знать, что мужчина, во время полового контакта, отдаёт женщине энергию одного года своей жизни: энергия трёх месяцев идёт на закрепление Образа Духа и Крови, а энергия девяти месяцев на вынашивание плода. И если мужчина ведёт беспорядочную половую жизнь, то он растрачивает понапрасну свою Энергию Жизни, что приводит к преждевременному старению, облысению. Академик Павлов отмечал, что смерть человека до 150 лет следует считать насильственной. Норма жизни нашего биологического тела 300-400 лет."


И такого было так много, что пришлось объяснять вроде бы взрослым и как бы образованным вещи самоочевидные. Как выяснилось, старался не зря. Узнал о телегонии и о своей персоне много нового и интересного.

Тем более хочется увидеть реакцию на мой труд здешней аудитории.


Итак, телегония.

Словом «телегония» обозначают мифический биологический закон наследования детьми самки признаков её первого самца. Иначе говоря, независимо от того, сколько самцов оплодотворяют самку в течение её жизни, потомство будет похоже на самого первого.

Начало этого суеверия связывают аж с Аристотелем. Авторитет его, достаточно высокий в античности, был вознесен до небес средневековыми схоластами. Соответственно вера во все его ошибки была безоговорочной. Потом это как-то притихло.

На рубеже Х1Х - ХХ веков о телегонии заговорили снова.

Самое забавное, что возрождение интереса к телегонии связано с именем величайшего биолога Чарльза Дарвина. Дарвин в одном из своих трудов привел описание случая с кобылой лорда Мортона.

=======

Она имела 7/8 арабской и 1/8 английской крови и была покрыта (в 1815 году) кваггой(вымершая ныне родственница зебры), без рождения потомства. В 1817, 1818 и 1823 годах эта кобыла была покрыта жеребцом её породы. Рождённые после этого жеребята были похожи (по жесткости шёрстного покрова, гнедой масти, по наличию тёмных пятен и полос вдоль хребта, по плечам и задним участкам ног) на кваггу в такой степени, как если бы они имели 1/16 крови квагги.

=======

Сам Чарльз Дарвин объяснял этот случай известными явлением атавизма – проявлением в потомстве признаков отдаленных предков. Но к широкой публике эта вполне банальная история попала в пересказе известного французского атеиста и слабого биолога Ле Дантека. Сей ученый муж писал: «Нельзя допустить, чтобы побочные дети не имели никаких признаков мужа их матери, если эта последняя хотя бы раз не была оплодотворена им… И ребёнок, родившийся от женщины, у которой ранее было много детей от разных партнёров, может иметь признаки ото всех этих предыдущих (партнёров) отцов.» И понеслось...


Экспериментальной проверке телегония подвергалась множество раз, в том числе и в России, в заповеднике «Аскания- Нова», где скрещивали лошадей и зебр. Были опыты с собаками и голубями в разных странах. Ни разу в строгих экспериментах телегония не наблюдалась.

Тем не менее, «идея пошла в народ». Явления, напоминающие телегонию, время от времени случались , что моментально подхватывалось и применялось для повышения благосостояния коне-, голубе- , собако- и прочих заводчиков. А тако же для пропаганды целомудрия и прочих вечно юных ценностей.


По большому счету, будь эта самая телегония реальностью, на неё молиться надо было бы! Завез в страну одного племенного быка из Аргентины, скажем. Он переимел всех тёлок в пределах досягаемости и готово! Коровы всю жизнь до мясокомбината рожают элитное потомство, какой бы бледной немочью их потом не покрывали.

Так нет же, отказывались скотоводы от таких огромадных сверхприбылей. Совесть у них гипертрофирована, не иначе. Или они просто были не дураки, в отличие от тех, кому впаривали сказки про телегонию?

В годы так это 1912 – 15 телегоническая ахинея резко сошла на нет. Почему? Народ тогда здорово интересовался успехами естественных наук, а наука пришла к переоткрытию законов забытого Грегора Менделя и родила генетику.


Не осиливших в средней школе основы этой замечательной науки, призываю повесить свои уши на гвоздь внимания, а мозги водрузить на стол понимания.

================

Наследственная информация дискретна, и от родителей к детям передается материальными носителями, именуемыми генами. Ген – это как бы атом или, точнее, квант наследственной информации. Расположены гены в особых внутриклеточных образованиях, именуемых хромосомами. У разных видов живых организмов своё число хромосом: от 2 до 1400. У человека – 46. Вернее, 23 пары. Во всех клетках данного организма хромосомы бывают только парами. Ген – эта та минимальная единица наследственной информации, которая определяет один признак (свойство организма). Один ген – один признак. (Я предельно упрощаю материал.) Совокупность генов данного организма называется генотипом. Совокупность признаков - фенотипом.


Гены существуют в двух вариантах – аллелях. Бывают аллели доминантные, сильные. При их наличии признак проявляется в фенотипе в том виде, что задается данным аллелем. Второй вариант – рецессивный аллель, слабый. В присутстувии доминантного он не проявит себя никак. Но, если в паре хромосом встретятся два рецессивных аллеля, то их действие проявится в фенотипе.


Всё выглядит просто. Но на самом деле гены не только непосредственно определяют признаки. Они еще взаимодействуют между собой: взаимно усиливают и ослабляют действие, включают и выключают, дублируют и блокируют... А организм, как таковой, его фенотип формируется еще и под влиянием факторов внешней среды.


Выше было сказано, что все клетки организма имеют двойной - диплоидный – набор хромосом. Все. Кроме половых. В генетике они именуются гаметами. Гаметы имеют половинный, гаплоидный набор. Следует отметит, что как носители наследственной информации гаметы - яйцеклетки и сперматозоиды – абсолютно равноправны.

При оплодотворении ядра гамет сливаются и образуется зигота – первая клетка будущего организма, несущая полный диплоидный набор хромосом. Из неё потом формируется новый организм. Генотип и фенотип нового организма определяются - в первую очередь – комбинацией доминантных и рецессивных аллелей в ядрах клеток и сложной игрой внутренних и внешних факторов.


Главное: свойства организма задаются в момент оплодотворения сочетанием материнских и отцовских генов из данных гамет, образовавших данную зиготу.

Ничего сверх этого в зачатии не участвует. Следующее зачатие будет результатом других, на тот момент данных, гамет. И ничего более.

=========


Сперматозоид – мужская гамета – это очень «слабая» клетка. Лишенный способности получать энергию извне, имеющий мнинимальный запас внутренних ресурсов, сперматозоид остается живым несколько часов во влагалище женщины и до трех суток в матке и фаллопиевых трубах.

Никаких других переносчиков генов, кроме хромосом в гаплоидных ядрах гамет, в природе не существует


Таким образом, трое суток – максимальный возможный срок присутствия мужской наследственной информации в женском теле.

Что мы имеем , усвоив вышеизложенное?

Что телегония даже в принципе невозможна!

Ни «очень редко», ни часто – никогда и ни при каких обстоятельствах.


У природы просто нет механизма для этого явления. Она невозможна, как ход игрушечных часов с нарисованными стрелками. Когда это выяснилось, телегония вроде бы еще раз и окончательно умерла. Туда ей и дорога.


Но в последние годы это суеверие снова подняло голову. Питательной почвой для этой «реанимации» стало новая научная безграмотность. Удивительная в наше время антинаучная истерия. Стремительный подъем религии и суеверий.

А «реаниматорами» - неонацисты, националисты и прочие борцы за «чистоту крови».

Но это отдельная большая, сложная и крайне неприятная тема.

Показать полностью
310

В двух словах о: развитии жизни

В двух словах о: развитии жизни Биология, Организм, Простейшие, Эволюция, Наука, Научпоп, Длиннопост

Давайте разберёмся: какие живые организмы существуют на нашей планете ╮( ̄ω ̄)╭

Всё началось с таксона" биота" (семечка нашего древа жизни) – это определение объединяет начало всех живых организмов на земле. Когда бессвязные молекулы начали образовывать связи с характерными, живым организмам, моделями поведения.

Первым такими организмами были прокариоты (корни нашего древа жизни). Это одноклеточные организмы, не обладавшие клеточным ядром. Эти организмы не могли образовывать многоклеточные системы, однако некоторые из них могли расти в виде волокон или клеточных масс (но каждая клетка в колонии была способна к самостоятельной жизни)


Тип питания таких организмов — это фотосинтез или химиосинтез.

Размножаются они в три этапа: первый адаптация (медленный рост и подготовка ко второй фазе) , второй экспоненциальный рост (пока питательные вещества не иссякнут) , третья сон (некоторые прокариоты пребывают в перманентном анабиозе размножаясь раз в сотни или
тысячи лет)

Их разделяют на два надцарства: бактерии и археи.

Бактерии – одна из первых форм жизни на земле. Они не имеют оформленного ядра и как правило мембранных органелл. Бактерия окружена мембраной, она выступает в роли барьера, удерживающего питательные вещества, белки и компоненты цитоплазмы внутри. Бактерии получают энергию за счёт разницы потенциалов по двум сторонам мембраны (как в батарейке).


Бактерии размножаются путём деления клеток. У большинства бактерий геном представлен в виде кольцевой молекулы ДНК.

Бактерии способны перемещаться за счёт жгутиков и осуществлять коммуникацию через химические системы, испускающие свет. Они зачастую формируют биоплёнки, обеспечивая защиту от врагов и усваивать питательные вещества более эффективно.

Сейчас бактерии доминирующая форма жизни на земле – их биомасса ( 5⋅1030 ) превышает суммарную биомассу растений и животных.

Археи – представляют собой одноклеточные микроорганизмы не имеющие ядра, а также каких-либо мембранных органелл. Раньше они были с бактериями в общей группе, но сейчас установлено, что археи имеют свою независимую эволюционную историю со многими биохимическими особенностями. Одной из таких особенностей является присутствие в клеточных мембранах липидов, содержащих простую эфирную связь.

В отличие от бактерий большинство представителей археи не является паразитом или патогенным организмом, однако они часто создают симбиотические связи.

Мембраны археи сильно отличаются от мембран других организмов, за счёт необычных черт фосфолипидов.

Они так же имеют жгутики – которые отличаются по строению и способу сборки от версии бактерий.

Археи питаются путём хемиосмоса. Некоторые группы используют в качестве источника питания солнечный свет, однако при этом не выделяют кислород.

Как правило они имеют одну кольцевую хромосому. Так же они могут поражаться вирусами, которые неродственны другим группам вирусов и имеют необычные формы строения.

Археи размножаются бесполым путём: делением, фрагментацией или почкованием.


Эукариоты (ствол нашего древа жизни) – это живые организмы, клетки которых содержат ядро. Считается, что они появились 1,6-2,1 млд. лет назад. Очень важную роль в их эволюции сыграл симбиоз между клеткой и поглощённой этой клеткой бактерией – предшественникам митохондрий и пластид.

Эукариотные клетки намного крупнее прокариотических, разница в объёме достигает тысяч раз и они включают в себя около десятка различных структур, известных как органеллы. Ядро – часть клетки окружённая двойной мембраной и содержит молекулы днк упакованные в хромосомы.

Из разделяют на четыре царства: растения, грибы, животные и протисты.

Растения – включает в себя: мхи, папоротники, хвощи, плану, голосеменные и цветковые растения.

Клетки растений имеют целлюлозные оболочки, а внутри находятся зелёные пластиды-хлоропласты. Жизнедеятельность растений регулируется фитогормонами, они растут в течении всей жизни.

Питания растения получают за счёт фотосинтеза и поглощения минералов и микроэлементов из почты.

Растения размножаются половым и бесполовым методом.

Главной особенностью растений является обогащение атмосферы кислородом, который необходим для выживания животных и аэробных организмов.


Грибы – царство, объединяющее в себе признаки как растений, так и животных. В это царство входят высшие грибы, плесень и хитридиомиценты.

У множества клеток грибов имеется клеточная стенка, которая состоит на 80-90% из полисахаридов (хитин или целлюлоза). Основа тела грибов – мицелий (система тонких ветвящихся нитей под землёй). Геном грибов состоит из ядерных и митохондриальных ДНК-содержащих структур. Число хромосом колеблется между 2 и 28.

Все грибы питаются усваивая минеральные вещества из окружающей среды, однако органические вещества они должны получать в готовом виде. Они выделяют ферменты в окружающую среду, которые вне организма расщепляют полимеры до легко усваиваемых мономеров, которые всасываются в цитоплазму.

Большинство грибов способно к вегетативному, бесполому или половому размножению и в целом формы их размножения очень разнообразны.

Грибы являются значительной частью экосистемы планеты. Помимо этого, самый большой организм на планете — это гриб возрастом 2,5 тысяч лет и весом более 400 тон.


Животные – царство многоклеточных организмов, ведущих активный образ жизни и питающихся другими организмами. По источнику питания их делят на растительноядных, плотоядных, всеядных и паразитов. В настоящее время описано более 1,6 млн видов животных (1,3 млн из которых членистоногие, 118 тыс. моллюски и 42 тыс. позвоночные).

Животные очень сильно отличаются по продолжительности жизни, один из самых долгоживущих – это колония кораллов возрастом более 2700 лет.

Животные значительно отличаются внутри своего царства, как итог существую множество вариаций их классификации. Большая часть животных (99%) относится к таксону Двусторонне-симметричные, который имеет 2 дочерних таксона: Xenacoelomorpha (червеобразные обитатели морей) и Nephrozoa (практически все остальные животные).

Nephrozoa разделяется на два токсона: первичноротых и вторичноротых. Эти токсоны довольно сильно ветвятся и заслуживают отдельного поста о них, добавлю лишь что путь нашего вида выглядит так: Двусторонне-симметричные – Nephrozoa – вторичноротые – хордовые – млекопитающие – приматы – гоминид – Homo – Homo sapiens.


Протисты – сюда относят все эукариотические организмы, не входящие в состав животных, грибов или растений. Их традиционно делили по схожести с вышеописанными царствами: животноподобные, растениевидные и грибоподобные, однако сейчас классификация переживает ряд изменений, которые произойдут на основе данных, полученных по средству биохимии и генетики.

Тут же хочу отметить, что многие выносят в ранг отдельного царства группу эукариотов «Хромисты», но с этим далеко не все согласны. Я тоже считаю что «треш группы» протисты – вполне достаточно для описания оставшихся организмов и всё большее дробление лишь создаёт путаницу.


Вирусы – отдельны таксон изначальной биоты (после прокариотов и эукариотов). Сразу хочу отметить, что принцип классификации вирусов очень разнится и даже ведутся споры, считать ли их живыми организмами. В целом это неклеточный инфекционный агент, который может воспроизводится только внутри живых клеток.

У животных вирусы вызывают иммунный ответ, который чаще всего приводит к уничтожению болезненного вируса, однако некоторым вирусом, удаётся ускользнуть от иммунного ответа, они вызывают хронические болезни.

Происхождение вирусов неясно, согласно некоторым гипотезам вирусы могли быть: мелкими клетками, которые утратили часть генов и стали паразитическими. Вирусы могли возникнуть из сложных комплексов белков и нуклеиновых кислот или же появится из фрагментов днк или рнк, высвободившись из генома более крупного организма.

Зрелая вирусная частица (вирион) состоит из нуклеиновой кислоты , покрытой защитной оболочкой (капсидом). По структуре капсида вирусы классифицируют на 4 типа: спиральный, икосаэдрический, продолговатый и комплексный.

Вирусы демонстрируют огромное количество вариаций генома и они более разнообразны, чем растения, животные, археи или бактерии.

Жизненный цикл вируса состоит из: прикрепления, проникновение в клетку, лишение оболочки, репликация, выход из клетки.

Вирусы поражают все типы живых организмов и в большинстве несут негативные последствия для организма хозяина, лишь изредка образую симбиотические отношения.

Положительным свойством вирусов можно считать их вклад в эволюции жизни, ещё во времена уникального общего предка. Они являлись важным средством для переноса гена между различными видами, чем вызывали генетическое разнообразие и направляли эволюцию.


Как-то так мы и живём. Жизнь впервые возникла на нашей планете 4,1-3,8 млрд лет назад и в процессе эволюции и естественного отбора, пришла к разумной форме жизни, к которой мы и относимся. Теорий возникновения живых организмов на Земле довольно много, но для формирования жизни не нужны особо специфические параметры – её выживание и продолжительное существование, главная трудность для жизни в масштабах нашей бесконечной вселенной. ( ‾́ ◡ ‾́ )

Интересная информация:

Жизнь была на грани вымирания более 5 раз, один раз даже на грани полного уничтожения.

Смысл существования жизни на микроскопическом уровне – это передача и обеспечения существования днк кода, который и определяет успешность выживания организма. В философском смысле – жизнь и живые организмы: это способ вселенной познать саму себя.

Вероятнее всего: нынешние разнообразие жизни – это лишь малая доля от общего количества живых организмов существовавших ранее и вымерших в процессе естественного отбора.

Планирую писать такие букофы с картинками и дальше, буду рад единомышленникам в моей вк группе: https://vk.com/neonovicrabi

Спасибо за внимание :3

Показать полностью
460

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах

Для тех, кто в детстве читал научно-популярные книги 1970-х годов по техническим дисциплинам, давно уже настали скучные времена: про бозон Хиггса или особенности горизонта событий заряженной вращающейся чёрной дыры можно было прочитать ещё полвека назад. Сегодня областью, за прогрессом в которой сложно уследить, является биология. И если рунет заполнен материалами по техническим дисциплинам, что традиционно для России, то биология и биоинформатика представлены крайне слабо.


За последние 18 лет стоимость секвенирования человеческого генома упала в сто тысяч раз до $1000. При этом длина генома человека это три миллиарда нуклеотидов, а геном коронавируса SARS-CoV-2 состоит из всего 30 тысяч нуклеотидов. Учитывая дешевизну и актуальность, множество геномов коронавируса уже секвенировано и выложено в открытый доступ.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Геном коронавируса настолько короткий, что его можно открыть как текстовый файл в блокноте, а различия в нуклеотидной последовательности двух разных геномов видны невооружённым взглядом.


Скачать геномы одной кнопкой можно в GenBank'e , там же есть и начальный, референсный геном от декабря 2019 года из китайского Уханя. Геном это последовательность из всего четырёх типов нуклеотидов - А/Г/Т/Ц, то есть аденин, гуанин, тимин, цитозин. Соответственно, кроме минимальной описательной части и кучи букв A/G/T/C там ничего и нет. Пожалуй, это один из тех редчайших случаев, когда сбор данных для анализа занимает меньше времени, чем сам анализ.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Геномы коронавируса. Слева "начальный" геном из китайского Уханя от 2019 года, справа от 24 марта 2020 года, взятый у одного из инфицированных в США. Начало первого гена в геноме выделено синим цветом. Для удобства просмотра последовательность делят на столбцы одной ширины.



Что есть что?


К счастью, уже построена карта генома и известны нуклеотидные последовательности всех генов коронавируса. Например, первый ген кодирует белок orf1a, его первые 21 нуклеотида такие: ATGGAGAGCCTTGTCCCTGGT - как раз найдены и выделены на скриншоте. Зная начальные и конечные участки генов, не говоря уже о генах целиком, несложно разметить геном и понять что есть что в данном экземпляре коронавируса.



"Мусорная" ДНК


Какие-то участки генома не входят ни в один ген - это мусорная ДНК (РНК), которая не несёт наследственной информации и может мутировать (изменяться) как ей вздумается без вреда и пользы для вируса. Мусорной ДНК сформированы промежутки между генами, а также самое начало и конец генома. На картинке выше первые несколько строк как раз представляют из себя мусорную ДНК, и, например, первая строка не совпадает.



S-протеин


Так как геном во всех своих частях по сути одинаковый набор букв А/Г/Т/Ц, то для простоты анализа можно сфокусироваться на участке генома - на каком-нибудь одном гене.

За проникновение вируса в клетку отвечают белки (s-protein), выглядящие как шип на поверхности, в совокупности образующие ту самую "корону", давшую название этому типу вирусов. Именно на эти белки направлены создающиеся сейчас вакцины, которые должны остановить распространение эпидемии.


Если s-протеин мутирует быстро и сильно, то вакцины не будут поспевать за новыми мутациями, как в случае сезонного гриппа, Если медленно, то одна вакцина избавит человечество от проблем надолго.


Мутации гена, отвечающего за кодирование s-протеина мы и рассмотрим.

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Схематичное изображение коронавируса. S-протеин отмечен вверху справа



От слов к нуклеотидам


Весь геном коронавируса это около 30'000 "букв". Последовательность нуклеотидов гена s-протеина известна, их всего 3822 штуки. Вот, например, первые пятьдесят:

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAA


Вот последние пятьдесят:

АAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAA


Если, как Микеланджело, в каждом геноме отрезать всё что до этих первых пятидесяти букв и после последних пятидесяти, то останется ген s-протеина. Поместив каждый ген в строку экселя удобно подмечать мутации. Например, на скриншоте ниже у некоторых гонконгских инфицированных на 22-й позиции стоит G вместо обычного T:

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Скриншот с общими данными по геному и начальной частью гена s-протеина. Стрелками отмечены мутации (замены) Т -> G



Мутации


Геном или один ген это просто наследственная информация. По этой информации производится то, что уже в дальнейшем будет функционировать - белок (1 ген -> 1 белок). Мутация в гене это, обычно, и в нашем случае, замена одной "буквы" на другую. Некоторые мутации в гене приводят к изменению белка, некоторые нет. Некоторые слабо изменяют белок, некоторые сильно, что скорее всего приведёт к недееспособности вируса, так как сделанный по сильно мутированному гену белок будет неправильным и не сможет выполнять свои функции. С другой стороны, против изменённого белка может не подействовать вакцина, спроектированная под предыдущую "версию".


Пройтись циклом по всем геномам, найти ген s-протеина и поискать замены относительно начальной версии от 2019 года это несколько десятков строк простого программирования.



Визуализация


Традиционные линейные или столбчатые диаграммы не подходят для отображения 3822 нуклеотидов и их замен. Для наглядности удобнее расположить последовательность нуклеотидов как текст, слева направо, сверху вниз, а наличие мутации и их количество заменить цветом поля:

Как мутирует коронавирус и насколько это плохо? Смотрим на реальных примерах Научпоп, Наука, Биоинформатика, Геном, Туториал, ДНК, Видео, Длиннопост, Коронавирус

Wake up, Neo...


Цветами обозначено количество вариантов для данной "буквы" среди проанализированных геномов. Например, жёлтый цвет означает, что для данного нуклеотида существуют все три возможных варианта мутации и каждый из которых приводит к немного другой белковой молекуле. Если для "буквы" существует только одна мутация, и та безобидная, то цвет - ближайший к начальному фиолетовому.


Анимация по дням:

Мутации, мягко говоря, присутствуют, не одна и не две, и большинство несинонимичные. То есть те, которые изменяют белок "шипа" коронавируса. Но много это или мало в контексте мутации вируса и вакцин?


Исследователи говорят, что коронавирус SARS-CoV-2 мутирует относительно медленно. Например, сезонный грипп мутирует в разы быстрее. То есть можно рассчитывать, что вакцины, которые уже проходят клинические испытания на людях в семи лабоработориях, будут актуальны и эффективны продолжительный период времени. Раз так, ждём вакцину! =)


Источник: http://celado-ai.ru/blog/How-coronavirus-mutates-and-how-bad-is-it

Показать полностью 4 1
205

Первое обнаружение протеинов и ДНК динозавров

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Не успели мы посмеяться, над фейковыми новостями о создании эмбриона Т-рекса из куринного яйца, как в журнале National Science Review с импакт фактором 13.222 вышла научная статья Alida M. Bailleu и соавторов, под названием "Evidence of proteins, chromosomes and chemical markers of DNA in exceptionally preserved dinosaur cartilage" - "Признаки наличия белков, хромосом и биохимических маркеров ДНК в исключительно хорошо сохранившемся хряще динозавра" представляет доказательства сохранности белков и нуклеиновых кислот в образце динозавра Hypacrosaurus stebingeri (на иллюстрации) возрастом около 65 миллионов лет. https://academic.oup.com/nsr/article/doi/10.1093/nsr/nwz206/5762999

Fig 1. Внешний вид образцов динозвра Hypacrosaurus stebingeri и контрольного образца (современного страуса Эму) микроскопическое обнаружение объектов напоминающие хромосомы и делящиеся клетки.

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

А. Общий вид образца Hypacrosaurus(MOR 548) шейного позвонка. B. Микрофотография кальцинированных хрящевых лакун. C-D  структуры напоминающие делящиеся клетки и хромосомы динозавра под большим увеличением. E. контрольный образец шейного позвонка современного страуса Эму. F. Хрящевая ткань контрольного образца. G клетки замершие в процессе деления и хромосомный материал в контрольном образце.

Fig 2. Окрашивание Алкианским синим (маркер хрящевой ткани) срезов образца динозавра и сорвменного страуса.

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Внешний вид образцов A. хрящевой ткани динозавра и B кости динозавра. Окрашивание Алкианским синим хрящевой ткани C выявляет синее окрашивание (типичное для хондроцитов, клеток хрящевой ткани). D. Минимальное окрашивание костной ткани динозавра Алкианским синим. E-H контрольные образцы страуса эму, так же показывают ярко синее окрашивание хрящевой ткани и минимальное костной.

Данный результат показывает что в образцах действительно хрящь динозавра а не какая-то другая ткань.

Fig 3. Обнаружение ДНК в хондроцитах (клетках хряща) динозавра Hypacrosaurus stebingeri

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

Клетки хрящевой ткани динозавра (A-B), окрашивание Propidium iodide (С) и DAPI (D) на присутствие ДНК/Нуклеиновых кислот. (E-G) Контрольные образцы страуса Эму.

Fig 4. Обнаружение протеина Chick Collagen II в материале хряща динозавра Hypacrosaurus stebingeri

Первое обнаружение протеинов и ДНК динозавров ДНК, Парк Юрского Периода, Динозавры, Наука, Длиннопост

A-D. Иммунофлуоресцентный анализ антителами к протеину Chick Collagen II (зелёный сигнал) в ультратонких срезах материала Hypacrosaurus stebingeri и хряща современного страуса Эму (E-H). Чтобы подтвердить, что это именно коллаген II, авторы обработали образцы динозавра (C-D) и страуса Эму (G-H) коллагеназой II которая специфически разлагает коллаген II и получили ожидаемое снижение интенсивности сигнала. Чтобы подтвердить, что это именно коллаген II, а не какой либо другой протеин с которым антитела связываются неспецифически, авторы окрасили те же образцы антителами к коллагену I который в хрящевой ткани в норме не пресутствует и не получили сигнала. В дополнительных материалах к статье представлена так же контрольное окрашиве без антител к Chick Collagen II чтобы исключить неспецефическое окрашивание образца вторичными антителами с флоуресцентным маркером (зелёным хромофором) которые спецефически связываются с первичными антителами к Chick Collagen II, отсутсвие сигнала в контрольном образце подтвердило, что это действительно Chick Collagen II, а не случайное явление.

После прочтения статьи, из моей личной критики очень хотелось бы увидеть окрашивание Propidium iodide и DAPI образцов на котором видны хромосомы (Fig 1), оба красителя их должны окрашивать. Однако вероятно хромосомы замершие в процессе деления могли подвернуться большей деградации чем упакованные в ядре клетки и сохраниться только внешне без содержания нуклеиновых кислот. В плане внешнего вида окрашенного материала именно так ядра клеток и выглядят. Не могу не отметить, что ядро динозавра выглядит значительно меньше нормального ядра в обычной клетке современных млекопитающих, в соотношении размера ядра к клетке, но поскольку мы имеем дело со столь древним образцом возрастом миллионы лет малый размер может быть связан с деградацией в образце нуклеиновых кислот .


Данные результаты ставят под сомнение опубликованные в 2012 году Morten E. Allentoft и соавторами, предположения о периоде полураспада ДНК порядка 500 лет и принципиальную невозможность выделения и изучения ДНК динозавров. https://royalsocietypublishing.org/doi/full/10.1098/rspb.2012.1745. Разумеется от обнаружения нуклеиновых кислот, до полноценного или хотя бы частичного генома динозавра огромная пропасть. Тем не менее логичный следующий этап это вырезать ядра клеток из образца лазером и попробовать извлечь ДНК для проведения геномного сиквенса и совмещение с референсным геномом птиц, того же страуса Эму. Насколько часто в архивах встречаются образы сохранности приемлемого для выделения белков и нуклиновых кислот и  в каких условиях пребывал образец, что позволили выявить белки и нуклеиновые кислоты требует дополнительного изучения.

Показать полностью 3
845

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить

UPD к посту есть вопросы: #comment_163870237

_____________

Случилось так, что прошлом году я озаботился вопросом своего происхождения и решил сделать расшифровку своего ДНК через сервис MyHeritage.com.


От заказа набора по сбору ДНК до момента его расшифровки прошло около 2 месяцев. В этот срок входит доставка пакета из США - 2 недели, доставка пакета из Москвы в США - 10 дней, 2 недели на расшифровку ДНК в лаборатории и еще 7-10 дней у меня заняло дойти до почты, собрать образец и отправить его обратно. Возможно, у вас это выйдет немного быстрее. Кстати, проблем с отправкой образцов слюны по почте не возникло никаких, вопросов со стороны сотрудников не было.

Важный UPD. На текущий момент (14.03.2020) ни сайт MyHeritage.com, ни сайт 23andme.com не отправляют наборы по сбору ДНК в Россию. Скорее всего, это случилось после обращения депутата Госдумы РФ от Единой России в Генпрокуратуру. https://www.kommersant.ru/doc/4277236, статья от 5.03.2020.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

В итоге, за 74 доллара я получил расшифровку своего ДНК и анализ происхождения. Из полученного анализа я узнал, что я на 55,7% Прибалт, на 35,1% Восточноевропеец и на 2,4% Ашкеназский еврей (таки да). А также, что из 3000 найденных людей с совпадениями по ДНК, 800 человек проживает в США (скорее всего потому, что там делается наибольшее количество тестов).

UPD 2. Полученные данные по происхождению, похоже, сомнительны. Ссылку на отличный разбор алгоритмов, применяемых в ходе подобных тестов предоставил в ходе нашего спора пикабушник @Jockel, за что ему большое спасибо. https://biomolecula.ru/articles/samaia-bolshaia-semia

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

https://www.23andme.com/, кстати, берет за это подобное исследование - 199$.


На этом я тогда и остановился, так как дополнительная расшифровка по здоровью стоила еще баксов 70, а большого смысла я ней не видел.


Но недавно российский конкурент MyHeritage и 23andMe, компания Genotek, запустила акцию, в рамках которой, можно загрузить на их сайт данные расшифровки своего ДНК и получить информацию по нескольким разделам - здоровье, питание и характер по очень вкусной цене - 2495 рублей за раздел, что по нынешним временам составляет ~35$. Это при том, что обычно Genotek гораздо более жадные и за расшифровку каждого раздела берут по 9995 рублей.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост
О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Данные уже расшифрованного ДНК легко сгружаются в формате .csv из вашего личного кабинета MyHeritage, расшифровка на сайте Genotek занимает немногим менее суток

И вуаля, меньше чем за 100$ (с учетом текущих скидок у MyHeritage) вы получаете и анализ происхождения и анализ генетических рисков по 123 заболеваниям.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Примерно такой же анализ на MyHeritage стоит сейчас в районе 60$ и гораздо менее информативен, но более интересен тем, кто хочет проверить себя на наличие наследственных передающихся заболеваний типа муковисцидоза или болезни Канавана.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Данные, как тот или иной вариант гена влияет на здоровье, Genotek берут в том числе с сайта https://www.snpedia.com, это такая Википедия по человеческому геному, с выводами и предположениями по генам, основанными на опубликованных научных работах (зарубежных в основном), там вообще много интересной информации в открытом доступе, для тех, кому интересно.

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Но все это меркнет по сравнению с тем, какую бездну информации по вашему ДНК (у меня около 20 тыс записей) выдает сайт https://promethease.com, где в формате удобного кастомизируемого отчета можно увидеть описания различных генов и их вариантов как с сайта https://www.snpedia.com, так и открытые данные из базы 23andme.


Анализ уже расшифрованного ДНК с сайтов 23andme, MyHeritage и тд стоит у них всего 12$.


В отчете можно обнаружить какие-то базовые вещи - вроде цвета кожи и глаз, так и предрасположенности к заболеваниям типа рака или диабета. Также есть и совсем интересные вещи типа гена чувствительности к кислому вкусу, которая нормализуется с возрастом или, что стало для меня неожиданностью - вариант сочетания 5 генов, при котором достигается в 2,5 раза более эффективный сброс веса с помощью диеты с низким содержанием жиров (а не углеводов, как рекомендуют практически все фитнес-тренеры).

О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост
О генетических тестах и расшифровке вашего ДНК. Для тех, кто хочет узнать о себе больше и сэкономить ДНК, Днк-Тест, Днк-Генеалогия, Здоровье, Генетика, Медицинская генетика, Длиннопост

Рекомендую сразу скачать отчет от https://promethease.com себе на компьютер и запускать его в отдельном браузере, так как может время отклика может сильно увеличиться


Кто хочет тотально погрузиться в тему расшифровки ДНК вот https://isogg.org/wiki/Wiki_Welcome_Page целая база ресурсов по этой области знаний


Для меня это был полезный опыт, я обнаружил несколько рисков, которые буду еще дополнительно проверять - в тч низкая усвояемость железа (в связи с чем пониженный гемоглобин), повышенная чувствительность к кофеину а также информация по правильной диете с низким содержанием жиров.


Все вышеописанное - результат моего личного опыта и ни в коем случае не реклама, скорее полезный контент для интересующихся.


Для ЛЛ.

Расшифровку своего ДНК, анализ происхождения и генетические риски по здоровью можно осуществить примерно за 2 месяца времени и с бюджетом от 80$ через расшифровку ДНК на сайте MyHeritage (59$ сейчас) и дальнейший подробный анализ на сайтах компании Genotek (по 35$ за отчет) (если мало времени и не владеете английским) и https://promethease.com (12$ за отчет, гораздо больше информации и интересных моментов, но только на английском). Так что если вы давно об этом задумывались, но до сих пор не решались - сейчас отличный момент для этого.


Отдельная благодарность за пост Как я плевал в банку, чтобы познать себя камраду @gdemoyaboroda, который разбирал вопросы расшифровки ДНК гораздо более подробно, и где я и обнаружил в том числе информацию по https://promethease.com и по https://isogg.org/


Скрины мои, фотографии набора MyHeritage и схема по определению лучшей диеты и графика упражнений - взяты из интернета.

Итоговый UPD. В ходе дискуссии со специалистами в комментариях выяснилось следующее.


1. Проводимое компаниями типа MyHeritage, 23andMe, Генотек и тд генетическое тестирование затрагивает только 0,1% вашей ДНК (примерно 600 тыс генетических вариантов). Полученные в результате данные научно не достоверны, так как далеко не факт, что эти компании изучают важные участки генома. Практически полная расшифровка ДНК (95%) называется расшифровкой генома (590 миллионов генетических вариантов) и стоит гораздо дороже. Полную расшифровку генома в коммерческих целях не делают еще никому.


2. Полученные данные по вашему происхождению, похоже, сомнительны. Ссылку на отличный разбор алгоритмов, применяемых в ходе подобных тестов предоставил в ходе нашего спора пикабушник @Jockel, за что ему большое спасибо. https://biomolecula.ru/articles/samaia-bolshaia-semia.


3. Все общедоступные тесты, в данном случае и в наше время, пока что еще являются обычной профанацией. Да, они дают некоторое представление о потенциальных группах риска, но только и всего.


4. Исследования на конкретные предрасположенности к заболеваниям и наследственные заболевания пока еще стоят дорого. Примеры

https://www.kdlolymp.kz/pricelist/petropavlovsk

https://genetico.ru/prices?id=124


5. Открытые базы данных генетических вариантов SNPedia и https://promethease.com НЕ ЯВЛЯЮТСЯ достоверным источником информации, правильно соотнести полученные генетические варианты с их интерпретацией не представляется возможным.


6. Более достоверные открытые базы данных для изучения генетических вариантов - это ncbi, ensembl, genecards, geneontology, www.lrg-sequence.org - в них можно смотреть без биологического образования, но с хорошим английским и консультацией грамотного специалиста.


Итоговые выводы: Данные генетические тесты можно использовать только в развлекательно-познавательных целях, если не жалко денег. Для медицински достоверных результатов пока еще нужно идти в клиники и делать исследования на отдельные заболевания и панели. Можно сделать частичную расшифровку генома, но это будет гораздо дороже генетического теста и потом вам все равно придется дополнительно платить за интерпретацию данных в сторонних клиниках.


А пока ждем дальнейшего удешевления секвенирования и развития новых методов ускоренной генетической диагностики.

Показать полностью 8
Похожие посты закончились. Возможно, вас заинтересуют другие посты по тегам: