Сообщество - Как построить карьеру в науке
Добавить пост
21 пост 595 подписчиков

Популярные теги в сообществе:

41

Становление и развитие врача – случай С.Н. Фёдорова

Данная статья относится к Категории: Творческое развитие юношей и девушек

Становление и развитие врача – случай С.Н. Фёдорова Наука, Ученые, Медицина, Исследования, Познавательно, Офтальмология, Федоров, Врачи, Студенты, Видео, Длиннопост

«- Что же обратило ваше внимание на офтальмологию, что заставило избрать именно эту специальность?


- Я никогда не мечтал быть терапевтом или гинекологом. Думал о рентгенологии, потому что там много техники, думал о хирургии - мне она казалась очень мужественной специальностью. Но когда я пришёл на офтальмологию, то понял: вот специальность, которая мне нравится. Причём когда я чем-то занимаюсь, то всегда стараюсь следовать принципу: от общего к частному. Поэтому, начав заниматься фотографией, я прочитал все учебники и пособия, которые были мне доступны, касающиеся устройства фотоаппаратов, объективов, работы оптической системы и прочее. Оттого офтальмология явилась для меня такой находкой. И я сразу решил, что только ею и буду заниматься.


Когда на пятом курсе мы начали изучать офтальмологию, то я сразу поступил в кружок по офтальмологии, стал бывать в клинике и пропадал там по вечерам. Старался овладеть оборудованием, осматривал больных. Офтальмологическое оборудование действительно напоминает аппаратуру хорошего фотографа: оптика, поле зрения, сила роговицы, рефракция, «подкручивание на фокус» глаза при помощи очков. Всё было очень интересно и очень ясно. В середине интернатуры, на шестом курсе, - это был пятьдесят первый или пятьдесят второй год - меня стали брать в районы для ассистирования во время операций, и я даже начал делать первые операции самостоятельно. Одну из первых операций по экстракции катаракты сделал в станице Вешенской. Это километров 250 от Ростова. […]


После распределения в станицу Вешенскую:


Жизнь была однообразна. Единственное удовольствие летом - плавание. Каждое утро я часа полтора плавал. Во время жатвы в поликлинике было пусто, я спускался к реке, садился в лодку и плыл на другой берег Дона на прекрасный пляж. Немного загорал, потом плавал. Если кто-то приходил - какая-нибудь старушка подобрать очки, - то тетя Ксеня, санитарка, выходила на крыльцо и махала косынкой. Это был знак - надо возвращаться. Я снова переплывал Дон, одевался и через десять - пятнадцать минут принимал эту старушку. […]

Становление и развитие врача – случай С.Н. Фёдорова Наука, Ученые, Медицина, Исследования, Познавательно, Офтальмология, Федоров, Врачи, Студенты, Видео, Длиннопост

Конечно, я понимал, что стать хорошим специалистом в Вешенской не смогу. А мне хотелось чего-то достичь в своей области. Мы договорились с женой, что она попросит направление на Урал после окончания университета, и тогда я переберусь к ней. Так мы и сделали. Я поехал в Москву в министерство и получил перевод в Лысьву. Это небольшой город, но глазное отделение на 25 коек там все-таки было. Я стал и начальником станции «скорой помощи», которая состояла из одной машины и двух лошадей. Начинаю работать и оперировать. В течение первого года провел около сотни операций. Условия в Лысьве оказались значительно лучше Вешенских: были деньги, были инструменты, да и Пермь рядом - около ста километров.


Первый свой доклад я сделал на тему удаления хрусталика-капсуля при помощи специальной петельки. В то время удаляли только ядро хрусталика, а остальные части оставались в глазу, поэтому острота зрения у людей была не очень высокая. Я сделал операций пятнадцать - семнадцать и на «обществе» доложил об этом. […]


- Что изменило в вашей жизни и научной работе пребывание в ординатуре? Оправдались ли ваши надежды?


- Я думал, что буду учиться в ординатуре три года, но так совпало, что, когда туда поступил, ординатуру сократили до двух лет. Твёрдо решил, что за эти два года должен защитить диссертацию. Поставил себе целью работать в научном учреждении и заниматься разработкой новых методов лечения глаза. Начал энергично работать и, что, наверное, редко удаётся в ординатуре, за два года набрал материал и защитился.


Работал так: до трёх часов в глазной клинике занимаюсь всеми ординаторскими делами, затем еду через весь город в нейрохирургическую клинику и там исследую больных, изучаю состояние глаза при опухоли мозга или при воспалительном процессе в мозгу, изучаю поле зрения глаза при этих заболеваниях. Какова величина так называемого слепого пятна? Потом фотографирую глазное дно. К десяти часам вечера успеваю посмотреть пять-шесть человек, а потом опять еду в клинику. Проявляю плёнку, печатаю фотографии и возвращаюсь домой в одиннадцать, двенадцать, в час ночи. Так почти каждый день на протяжении полутора лет.

Становление и развитие врача – случай С.Н. Фёдорова Наука, Ученые, Медицина, Исследования, Познавательно, Офтальмология, Федоров, Врачи, Студенты, Видео, Длиннопост

За эти полтора года мне удалось обследовать около ста тридцати больных и получить научные данные по теме. Я пришёл к очень интересным результатам. Любой человеческий орган, несмотря на материальные изменения (отёк, кровоизлияние), длительное время, иногда до двух-трёх месяцев, сохраняет нормальные функции, что говорит об огромном запасе резервных механизмов. Диссертацию «Связь между слепым пятном и зрительным нервом при заболеваниях центральной нервной системы» я закончил в 1957 году и защитил её в 1958, поступив в ординатуру 1 октября 1955 года. На эту работу у меня ушло два года и два месяца. Защита прошла нормально, несмотря на то, что, по мнению некоторых офтальмологов, в ней была кое-какая ересь.


- Что изменилось в вашей жизни после защиты диссертации?


- Я сразу стал искать работу. В Ростове работы не было - глазных врачей больше, чем нужно, многие работают на полставки. Все места заняты, каждый ждет вакансии, а она может появиться, если кто-то уйдет на пенсию. Первое время, месяцев восемь, я работал ординатором в ростовской областной больнице. Наконец случайно встретился с женщиной, вместе с которой учился в ординатуре. Теперь она работала в Чебоксарах. Она мне предложила ехать к ним в филиал института Гельмгольца, где как раз нужен был заведующий клиническим отделением. У них имелись небольшие научные лаборатории и связь с Москвой. Она меня убедила. Я подал туда на конкурс, приехал в Чебоксары и получил в своё распоряжение глазное отделение.


Там было два отделения: хирургическое и трахомотозное. Трахома меня не волновала. Заболевание неинтересное и лечение консервативное. А хирургия привлекала. Здесь, в Чебоксарах, я пытаюсь создать новые инструменты, езжу по заводам. Там был неплохой электроаппаратный завод с проектно-конструкторским бюро и прекрасными мастерами. Мы жили в маленькой квартирке из двух комнатушек, находившейся во дворе нашего института. Мне часто не спалось по ночам. Мучила мысль, что опять что-то делаю не так, повторяю чужие идеи. В одну из бессонных ночей пришло решение серьезно заняться гистохимией. Создать мощную лабораторию для исследования глаза на молекулярном уровне, узнать, с чего начинается процесс помутнения: с нарушения в ферментах, в белках или проблема в окислительных процессах? Эта идея меня тогда завела, и наутро, после очередной ночи размышлений, я помчался в библиотеку и взял книгу Пирса «Гистохимия». Но быстро понял, что у нас в Чебоксарах идея создания такой лаборатории вряд ли осуществима - невозможно достать наборы химикатов, они были очень дорогие, один грамм стоил пятьдесят тысяч. Это меня остановило. Через месяц я наткнулся на статью в иностранном журнале, где говорилось о том, что во время операции экстракции катаракты можно заменить хрусталик глаза. Я стал искать и нашёл ещё несколько статей по этой теме, все иностранные, но была одна и наша. Хрусталики имплантировали в Англии - доктор Ридли, в Голландии - врач Бинхорст. Я тоже решил попробовать их сделать. Тем более что фотографии хрусталиков у меня имелись и размеры их были ясны. С этой идеей я пошел к заместителю директора филиала Цилии Юзефовне Каменецкой. Она посмотрела на меня, как на инопланетянина, полагая, что это абсолютно нереально: если уж в Москве не делают, то в Чебоксарах это совершенно невозможно. Такая реакция меня не остановила, я помчался по всем городским лабораториям. В одной из них Бессонов пообещал сделать линзочку - искусственный хрусталик. Взяв за основу шарикоподшипник, он сделал подобие штампа; выдавил одну поверхность, другую, и, если между этими поверхностями вставляли кусочек пластмассы и нагревали его, получалась линзочка. Первая вышла малопрозрачной и корявой и, конечно, нигде не использовалась».


Автобиография (интервью с С.Н. Фёдоровым), в Сб.: Святослав Фёдоров. 600 тысяч часов полёта. Книга памяти, М., «Фонд развития передовых медицинских технологий имени Святослава Фёдорова», 2002 г., с. 27-31.


Источник — портал VIKENT.RU


Дополнительные материалы

+ Плейлист из 15-ти видео: ЛИЧНОСТЬ: ЦЕЛЬ, СМЫСЛ, РАЗВИТИЕ

+ Ваши дополнительные возможности:

Идёт приём Ваших новых вопросов по более чем 400-м направлениям творческой деятельности – на онлайн-консультацию № 279 20 марта 2022 года (Воскресенье) в 19:59 (мск). Это принципиально бесплатный формат.


Задать вопросы Вы свободно можете здесь: https://vikent.ru/w0/


Изображения в статье

Святослав Николаевич Федоров — русский врач-офтальмолог, В 1960 году изобрёл искусственный хрусталик и провёл успешные эксперименты по его имплантации. В 1986 году создал Межотраслевой научно-технический комплекс «Микрохирургия глаза» / РИА Рустим

Изображение Parentingupstream с сайта Pixabay

Изображение Roberto Lee Cortes с сайта Pixabay

Показать полностью 3 1
35

Авторство в научных статьях

Авторство в научных статьях Научная работа, Авторство, Наука, Аспирантура, Длиннопост

Международные публикации имеют следующие категории авторов.

1. First Author (Первый автор) – человек выполнивший наибольшую часть научной работы. Наибольшая часть подразумевает практическую экспериментальную работу, обработку данных и разработку идеи. Зачастую первый автор так же ответственен за написание черновика научной публикации. Когда опубликованная статья будет цитироваться и в статье больше чем 2 автора, то цитата будет выглядеть “Smith et al., 2020”. Статус первого автора особенно необходим аспирантам для защиты диссертации Ph.D. и для постдокторантов (Postdoc) для дальнейшего развития академический карьеры. Важность статей первым автором значительно теряет актуальность после достижения учёным статуса Профессора-Ассистента. (Assistant Professor), но всё равно может быть полезной при высоком уровне Импакт-фактора публикаций и для повышения шансов на получение гранта, так как при оценке исследователя учитываются его публикации первым авторов по теме гранта.


2. Corresponding author (Автор респондент) – Автор, который несет ответственность за научную работу в целом и гарантирует корректность данных и отсутствие этических нарушений в экспериментальной работе. Имя и контактная информация респондента указывается в статьях после списка авторов титульной страницы. В обязанности респондента входят так же процесс подачи статьи в журнал и общение с редакцией научного журнала. А так же ответы на вопросы по статье после публикации. Статьи с авторством в данном статусе статусе играют большую роль для дальнейшего развития карьеры, Профессора Ассистента, показывая его вклад как ментора для первых авторов.


3. Last author (Последний автор) – автор который внёс наибольший вклад в материальную составляющую научной работы. Как правило это профессор или заведующий лабораторией (Primary Investigator) где была выполнена научная работа или же последний автор сделал наибольший финансовый вклад. Часто последний автор берёт на себя функции автора респондента, но эти статусы могут принадлежать и разным людям.


4. Co-author (Соавтор) – все остальные участники научной работы вне зависимости от их позиции в списке имён, теоретически очерёдность имён указывает на значимость вклада в научный проект, но в действительности на это никто не обращает внимание. Статус соавтора повышает общий рейтинг цитирования соавтора например на Google Scholar, но в целом не несет значительного позитивного влияния на карьерный рост. Считается нормой, наличие множества работ в соавторстве, показывая обширные связи учёного и его участие в различных проектах, но только при наличии статей в статусе первого и corresponding author. Невозможно развивать академическую карьеру имея только публикации со-автора.


Редкие случаи.


5. Single author (Единственный автор) – тут всё просто, единственный автор выполняет все функции проекта и статья должна быть написана от первого лица. "I studied…", "I evaluated", "My conclusion" и так далее. Как правило в современной науке статьи с единственным автором встречаются в форме открытых писем в журнал “Letter to the editor”. Экспериментальные статьи с единственным автором встречаются редко и редакторы и рецензенты их не любят. Собственно разница в стиле “We” и "I” послужила причиной возникновения автора Ф. Д. Ч. Уилларда который на самом деле был котом! в ряде статей по криогенике. Учёный Джек Х. Хетерингтон написал статью используя “We” в то время как он был единственным автором. Поскольку статьи в то время печатались на печатной машинке, учёный не хотел переписывать весь текст заменя «We» на “I” соотсвественно формы всех предложений и просто добавил своего кота в со-авторы.


6. Two authors (два автора) - Встречается немного более часто особенно в малых научных группах, например завлаб и постдок. Принципиальная разница такого соавторства в том, что когда авторов только двое, то они по умолчанию считаются equal contribution и при цитировании указываются “Smith and Johnson, 2020”. Так что если ваш профессор в этой ситуации хочет выступить первым автором, то проблемы здесь нет, однако как только появляется третий автор, ситуация становится стандартной "Smith et al., 2020" и преимущества двух авторов для второго автора теряется. Будьте осторожны, так как предложение о двойном авторстве где вы второй автор, может быть хитрым ходом. Сначала вы соглашаетесь на второе авторство, а потом профессор добавляет ещё 2-3 человек, ведь на второе авторство вы ведь уже согласились.


Какие чаще всего возникают сложности с соавторством и конфликтные ситуации?


1. Когда корреспондент или последний авторы хотят занять первое авторство.

Хотя с практической точки зрения это действие не несет большой пользы, данный шаг сдерживает вашу карьеру заставляя либо брать дополнительные годы в докторантуре или оставаться постдокторантом если вы постдок. Если профессор или завлаб настаивают на данном решении объясняя данный поступок какой-либо текущей надобностью (например подачей нового гранта), нужно искать другую лабораторию. Потому что суть в том, что это действие направлено против вас. Теоретически, данная ситуация попадает под академический харрасмент, но подавать официальную жалобу это очень плохая идея. Не забывайте, от вашего профессора в будущем вам понадобятся рекомендательные письма, которые в случае плохих отношений он может либо не дать вовсе или написать негативные. Сложности с получением рекомендаций одна из серьезных причин невозможности трудоустройства после получения Ph.D. Да, академический мир в этом плане местами кошмарен.


2. Вам в нагрузку просят добавить авторов которые не принимали участия в научной работе или их участие минимальное.

Проблема достаточно распространённая. Если вас просят добавить со-авторов в статью, не возражайте, с практической точки зрения для вас это не играет значительной роли, если вы по прежнему остаётесь первым автором, какая вам разница, что в статье 10 дополнительных авторов. Да в реальности только 2-3 человека в принципе сделали что-либо для проекта, а добавить просят всех. Поскольку ваша задача преуспеть в своей научной карьере, а не защищать интересы абстракной “правды” спорить здесь не нужно. В целом в данной ситуации вы лично ничего не теряете, а хорошие отношения с коллегами которых вы согласились включить в статью, могут принести пользу в дальнейшем. Могут и не принести, но вы ничего не теряете.


3. Equal contribution (Равный вклад) – Используется он когда второй автор сделал так же значительный вклад в статью сопоставимый с вкладом первого автора. На практике, второй автор с равным вкладом считается соавтором со всеми негативными последствиями данного положения. Некоторые журналы вообще игнорируют данный факт, некоторые ставят малозаметную отметку, которую ещё нужно поискать. В плане цитирования, и карьерного продвижения, второй автор с равным вкладом это всё равно просто со-автор. Единственная ситуация с equal contribution вторым автором которая может принести вам серьёзную пользу - это защита диссертации. Вторые авторы с пометкой equal contribution могут использовать статью в своей защите, но только при условии что первый автор не будет использовать данную статью в собственной диссертации. Опять же требования и условия для защиты сильно отличаются между странами и университетами. Поэтому если вы постдокторант и уже защитились, и ваш профессор просит поставить аспиранта вторым автором с равным вкладом – соглашайтесь. Вам это ничем не навредит, а профессор просто пытается подстраховать успешную защиту студента. Однако если вас пытаются бортануть на позицию второго автора с равным вкладом, берегистесь, постдокторанту это практически ничего не даёт. Если вы сами аспирант, можно скрипнуть зубами согласится, но тогда требуйте бумагу о том, что первый автор не будет использовать данную работу в своей защите (если он тоже аспирант), до публикации статьи. Хотя в этом может быть вся и суть смены авторства, более приоритеному аспиранту не хватает статьи до защиты, а сроки поджимают. Опять же прежде чем начинать войну и строчить жалобы, не забывайте именно ваш профессор подписывает документы допуская вас к защите. Не стоит обострять отношения имея столь слабые позиции.


4. Клинические доктора MD/Ph.D. и жизнь постдока.

Если вы постдок и вас ставят в ситуацию, “Сначала напишем статьи для всех аспирантов, чтобы они защитились, а потом и ваша очередь дойдет", ищите другую лабораторию. Исключение если есть хорошая перспетива получить постоянную позицию в данной конкретной лаборатории. И перспетива строчить потоком статьи для врачей вас устраивает. Очень часто подобная ситуация возникает в клинических кафедрах, где практикующие врачи, для галочки (и для более высоких руководящих должностей в клинике) пишут Ph.D. наука им, как правило, не интересна и не нужна, помогать они вам практически не будут (исключения бывают, но на то они исключения), писать такие статьи удовольствие ниже среднего. Поэтому ищите другую лабораторию, либо обговариваете условия работы на защиту аспирантов если вы постдок. Запомните, первые 2-3 года постдока, вас не интересуют статьи в статусе соавтора и равного вклада если вы второй автор.


Что делать если у меня отбирают авторство?

В первую очередь постараться понять, причину данного действия вашего профессора или завлаба в отношении Вас. Обычно это исходит из того, кого ставят первым автором в данной работе. Если это аспирант, то профессору защита этого аспиранта более важна чем ваша защита или карьера. Если это сам профессор то у него серьёзные амбиции и, опять же, ваша карьера в его планы не выходит. Если это не какой-то изолированный случай, а систематическое явление, то нужно искать другую лабораторию.  Если вы всё ещё аспирант, защищаться на тех условиях, которые вам доступны и искать постдок в другой группе. К сожалению, практика показывает, что жаловаться университету или тем более журналам занятие бесперспективное. Журналы имеют дело с автором корреспондентом и очень не любят конфликтов с авторством. Научная среда слишком компактная, а ситуация конфликта аспиранта с профессором или постдока с завлабом может сильно усложнить жизнь и карьеру первым и мало повлиять на вторых. Особенно если вы иностранец в чужой стране. Если профессор или завлаб настаивает на определённом авторстве, которое вас не устраивает, продуктивнее согласиться и начать искать другую лабораторию, чем идти на открытый конфликт. После аспирантуры, проверяйте авторство опубликованных статей, прежде чем устраиваться в ту или иную лабораторию, зачастую тенденции можно определить просто полистав список публикаций за последние несколько лет и отследив карьерный путь сотрудников группы.


Публикации со старого места работы

Часто возникает и другая ситуация, вы работали над проектом, но сменили место работы до его публикации, впоследствии обнаруживаете, что вас подвинули с первого автора в со-авторы, а то и вовсе проект издали вообще не указав вас в авторах. Часто случается с пост докторантами, куда реже с аспирантами, но тоже бывает. Обычная практика, профессору или завлабу не выгодно ставить автором человека который уже с ним не работает. Намного продуктивнее поощрить нового сотрудника, авторством. Тщательно обговаривайте авторство проектов, которые вы не успели опубликовать до вашего отъезда. Старайтесь издавать проекты до того как уйдете из лаборатории, чтобы они хотя бы были на стадии ревизии и по возможности опубликованы на сервере препринтов. Тогда подвинуть вас в авторстве будет намного сложнее, так как нерецензированная версия висит он-лайн.


Если вас указали со-автором, а вы претендовали на первое авторство?

К сожалению доказать ведущий вклад в работу будет практически невозможно. Ваша бывшая лаборатория ведь не отрицает факт вашего участия Вы соавтор, а степень вклада каждого участника вещь очень относительная. Если вас не указали совсем, то тут можно обратиться к журналу предоставив доказательства вашего участия в опубликованной работе. Стоит ли это делать, решать вам в лучшем случае журнал опубликует коррекцию добавив вас в соавторы, ценность такой публикации в целом для вашей карьеры низкая, а вот отношения с бывшей лабораторией будут испорчены. В целом, покидая лабораторию, нужно исходить из того, что весьма вероятно, первое авторство у её не опубликованых проектов вы потеряете.


Если статью украл другой исследователь?

Самая неприятная ситуация, это полное воровство научной работы, это может произойти во время конференции (не давайте фотографировать ваш постер!) либо по собственной доверчивости (не давайте копии и презентации неопубликованных работ малознакомым да и знакомым людям!). Тут нужно, определять источник “утечки”, однозначно идти на конфликт связываться с журналом и предоставлять доказательства. К счастью встречаются такие ситуации не очень часто.


Подводя итог, авторство очень важный аспект карьерного роста учёного, однако успешная карьера складывается не только из одних публикацией.  Фокусируясь на одном конкретном проекте или ситуации, старайтесь не терять из виду картину в целом. По возможности, избегайте конфликтов, но и не позволяйте себя использовать. Помните, подход итальянской забастовки, когда вы формально не отказываетесь, но и не прилагаете особых усилий даст вам намного больше вариантов решения проблемы, чем открытое противостояние. Имейте несколько научных проектов, на случай если с одним или несколькими, что-то пойдет не так.

Показать полностью
29

Как генерировать и заказывать qPCR праймеры

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

qPCR - полимеразная цепная реакция в реальном времени эффективный метод определения экспрессии генов, на основе амплификации исходного объёма мРНК. Для выбора генного сектора амплификации требуется пара олигонуклеотидных праймеров 3'-Front и 5’-Reverse, которые помечают участок амплификации. Этот материал расскажет как без особого опыта и знаний создать дизайн праймеров и заказать их синтез.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

http://useast.ensembl.org/index.html

Для начала нужно определить индекс транскрипта для выбранного гена. В этом примере мы рассмотрим ген кодирующий протеин CXCL5 так же нужно выбрать биологический вид, с которым мы работаем, зависит, откуда вы извлекли вашу РНК, в данном примере это мышь CL57BL6. Теперь нажмите "Go" для поиска.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

И из полученного списка важно выбрать не сам ген, он обычно идёт первым в поиске, а именно транскрипт.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Теперь нажимите на транскрипт в полученном списке нужно скопировать Transcript ID в абсолютном большинстве проектов нас интересует протеин кодирующий Protein coding, не содержащий интрона в этом примере Transcript ID следующий: ENSMUST00000031318.5

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

https://lifescience.roche.com/en_us/brands/universal-probe-library.html

Дальше нам на основании полученного Transcript ID нужно определить нуклеотидную последовательность сделать это можно здесь на сайте Roche LifeScience в онлайн системе Universal Probe Library.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Нажмите Assay Design Center и начните с выбора целевого организма. Опять же в данном случае это мышь Mus musculus (Mouse). Теперь впишите в строку Specify your target(s) Transcript ID полученный выше и нажмите Enter или копку Design.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Собственно вот и результат:

CXCL5 3’ tcttgggtgtgttaagagtgttct

CXCL5 5’ cacagcagctttctaaaaccataa


В системе Universal Probe Library прямой праймер 3’ называется left primer, а обратный 5’ right primer, но не суть. Собственно это готовая последовательность qPCR праймеров для синтеза. Чуть ниже сиквенса можно посмотреть карту транскрипта относительно всего гена.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Если вы получили предупреждение об отсутствии интронной сепарации в дизайне праймера, обязательно проведите цикл обработки ваших РНК образцов ДНКазами, для полной фрагментации остаточной ДНК, так как без интронного разделения праймеры могут амплифицировать как cDNA так и обычную ДНК, что может сильно повлиять на конечный результат. Обрабатывать выделенный образец РНК, ДНКазами нужно сразу после извлечения и, разумеется, до синтеза cDNA иначе ДНКазы разберут и её.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Собственно с первым этапом определения Transcript ID можно было бы особенно не заморачиваться, а сразу ввести интересующий нас ген в Universal Probe Library, но тут можно допустить ошибку. Дело в том, что Universal Probe Library предлагает самые разные варианты транскриптов с куда меньшим объёмом сопровождающей информации, закажешь по ошибке не кодирующий или просто не тот конструкт, а потом будешь гадать, почему амплификация не происходит и вместо результатов, qPCR показывает шум. Мелкая ошибка или невнимательность, которая может стоить месяцев работы впустую.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Итак, осталось заказать нуклеотидную последовательность. Фирм которые предоставляют такие услуги множество, выбор часто зависит от того с кем у вашей лаборатории заключён контракт на обслуживание или если на кампусе есть олигонуклеоитидный сиквенсер. Я обычно заказываю через сайт Thermofisher


https://www.thermofisher.com/order/custom-oligo/enterSequences


Всё что нужно это указать название вашего гена, использовать можно только буквы и цифры. Затем нужно вписать название олигонуклеатидной цепи и указать нуклеатидную последовательность. Затем нужно нажать Add Oligo и повторить процесс для обратного праймера. Осталось нажать Add to cart и перейти к оплате. Цена за одну последовательность 5$ при условии, что используется объём в 25 nmole, стандартный режим очистки и доставка в лиофилизированном виде, хотите уже готовый к использованию праймер можно доплатить ещё около 5 долларов и получить готовое разведение, но RNAse free water стоит дешево и лучше разводить праймеры самому. К тому же лиофилизат, хранится намного дольше.


Разумеется, это полностью автоматический режим синтеза праймеров для qPCR, при желании и понимании того как работает процесс амплификации вы можете выбрать другой фрагмент создать свой собственный праймер с интронной сепарацией, протестировать несколько вариантов праймеров с вашим qPCR оборудованием, и так далее для этого существует масса программного обеспечения например https://www.ncbi.nlm.nih.gov/tools/primer-blast/, но это тема другого большого поста. Этот гайд больше для тех, кому нужно готовое решение для немедленного практического применения. Определение правильного сиквенса можно опустить и сразу перейти к заказу последовательности, если вы копируете праймеры из уже опубликованной статьи, однако и тут могут быть подводные камни, не всему что опубликовано в научных журналах можно безоговорочно доверять.

Как генерировать и заказывать qPCR праймеры ДНК, РНК, ПЦР, Qpcr, Наука, Праймер, Длиннопост

Удачных амплификаций и чистых результатов.

Показать полностью 11
26

Ph.D. в Японии через Стипендию правильетства Японии Monbukagakusho: MEXT программа: "Стажер-исследователь"

Ph.D. в Японии через Стипендию правильетства Японии Monbukagakusho: MEXT программа: "Стажер-исследователь" Япония, Аспирантура, Наука, Phd, Длиннопост

В 2009 году я уехал по этой программе в Японию, где бесплатно закончил аспирантуру. Программа рабочая хотя и отбор достаточно серьёзный. Значительное преимущество имеют люди которые хотят именно обучаться по научным дисциплинам, так значительное число аппликантов подаёт на обучение Японскому языку и Японской культуре. Где как раз требуется высокий уровень знания японского языка. Большой плюс, для этой программы не требуется наличие международных публикацией на английском языке. Если у вас есть публикации на русском языке их можно перевести и это будет плюсом.


Требования:

-Быть гражданином России.

-Не получать данную стипендию в прошлом.

-Требования к знанию языка: японский или английский на уровне достаточном для обучения. Формулировка здесь размытая, на практике нужен intermediate и выше.


Кое какая полезная информация:

1. Японский язык - при подаче документов не требуется для экзаменов и интервью, если аппликант подаёт на научные дисциплины не связанные с Японским языком. Жизнь в Японии без знания японского языка непростое приключение, но я знаю многих коллег кто успешно завершил программу без значительного изучения японского. Первые месяцы и если будет время в дальнейшем, можно будет усиленно изучать Японский язык при университете, чтобы немного наладить быт.

2. Изначально человек поступает на программу стажёр-исследователь которая продолжается от 6 до 24 месяцев в течении которых можно заниматься научной работой, а можно изучать японский язык и осваиваться в Японии.

3. Чтобы поступить в аспирантуру (Ph.D.) нужно иметь 18 лет обучения вместе со Школой. Например 10 лет школа + 6 лет Медицинский институт + 2 года ординатура. Для не медицинских специальностей нужно 10 лет школы + 5 лет университета + 3 года аспирантуры.

4. Если 18 лет не набирается, можно попробовать перейти из программы стажер исследователь в Магистратуру и уже после магистратуры поступить на Ph.D. Я так не делал, нюансов не знаю. Но знал немало студентов из России которые пошли по этому пути.

5. Перелет в Японию и обратно оплачивает правительство Японии.

6. Ph.D. полученная в Японии признается институтами США и Европы.


Стипендия: Суммы, перечисленные ниже, оплачиваются в зависимости от курса обучения. В связи с изменением бюджета правительства Японии размер стипендии может меняться каждый финансовый год. Стипендия аннулируется, если стипендиат отсутствует в университете в течение длительного периода.


Студенты, студенты в статусе «стажера-исследователя»: 143,000 йен в месяц


Для студентов магистратуры: 144,000 йен в месяц


Для студентов докторантуры: 145,000 йен в месяц


(1200-1300$ в месяц, в 2009 стипендия была немного выше около 1400$). Если получить разрешение на работу можно немного подрабатывать. Возможности для подработки сильно зависят от ваших возможностей и обстоятельств. Многие знакомые преподавали русский язык. Некоторые подработки очень необычные, я например как-то снялся в Японском сериале NHK в эпизодической роли русского солдата. 


Если не ставить задачи жить в Токио и Осаке на данную сумму можно достаточно комфортно жить, на семью однако будет хватать с некоторой экономией. У многих моих коллег по программе в Японии жили не работающие супруги с детьми.


https://www.ru.emb-japan.go.jp/itpr_ru/STUDENT_2020.html - Подробности программы и документы за прошлый год. В начале февраля 2020 Японское посольство и консульства опубликуют подробности подачи документов на 2021. Весь процесс от подачи документов до выезда в Японию занимает около года.


Подавать документы можно по почте в посольство или консульство Японии своего региона. В 2008 году я заносил в посольство лично, но сейчас могло измениться и возможно подавать можно только по почте.


Если по конкурсу документов вы пройдете вас пригласят на экзамен. Он состоит из Английского и Японского языков 3 уровней сложности. Если японского вы не знаете, в экзамене по Японскому языку вы всё равно принимаете участие, отвечайте наугад, какие-то баллы наберите. Все экзамены это выбор из 4 вариантов правильного. Экзамен заполняется простым карандашом.


По результатам экзаменов Вас (возможно) пригласят  на интервью где вы должны объяснить комиссии, чем ваше обучение в Японии принесет ей пользу и чем вы собираетесь заниматься.

По научным дисциплинам ответить на этот вопрос достаточно просто. В целом интервью простое, поскольку вас специалиста, оценивают сотрудники консульства (в вашей области не специалисты).


Если прошли интервью вам выдадут сертификат на обучение и контактную информацию Японских вузов.


Нужно будет за несколько месяцев найти профессора который вас с этой стипендией возьмет к себе на кафедру и отправить ему этот сертификат на подпись, после чего, получить от него подписанный документ о принятии вас в программу и отнести этот документ в посольство.


За несколько недель до вылета вам в посольстве оформят студенческую визу, если я правильно помню виза G. (Полагаю от Gakusei).


Вылет в Японию как правило либо начале Апреля либо в начале Октября у вас будет возможность выбрать либо Апрель или Октябрь, чтобы спланировать завершение дел в России. Однако дату и время вылета выбрать вы не сможете.


Контактный телефон Информационного отдела Посольства Японии в России: (495) 229-2574

http://www.ru.emb-japan.go.jp


https://vk.com/mextscholarship - подборка полезной информации о заполнении документов и других нюансах программы от участников прошлых лет.


Что-то могу рассказать о своем опыте, но мои знания устарели на 10 лет.

Показать полностью 1
24

Отбор статей для спецвыпусков научных журналов Frontiers in Immunology и Processes

Отбор статей для спецвыпусков научных журналов Frontiers in Immunology и Processes Наука, Научные журналы, Научные работы, Научные открытия, Биология, Молекулярная биология, Молекулярная генетика, Лаборатория, Длиннопост

Думаю эта информация может быть интересна сотрудникам Российских научных групп. Я занимаюсь созданием спецвыпусков для двух научных журналов Frontiers in Immunology (IF 7.561) а так же Processes (IF 2.947) и ищу публикации для обоих выпусков. Возможно среди Российских научных групп есть люди работающие над микроглией или диабетом. Спецвыпуск это сборник статей определённой научной тематики с ускоренным процессом научного рецензирования. Научные статьи принимаются только на английском языке.

Тема: Exploiting New Methods to Study Microglia in Healthy and Diseased Retina

Журнал: Frontiers in Immunology

Impact factor: 7.561

Отбор статей для спецвыпусков научных журналов Frontiers in Immunology и Processes Наука, Научные журналы, Научные работы, Научные открытия, Биология, Молекулярная биология, Молекулярная генетика, Лаборатория, Длиннопост

Иллюстрация: J Neurosci . 2014 Jun 11;34(24):8139-50. doi: 10.1523/JNEUROSCI.5200-13.2014. Suppression of microglial activation is neuroprotective in a mouse model of human retinitis pigmentosa


Тематика выпуска: Микроглиальные клетки сетчатки и всё, что с ними связанно. Дегенеративные заболевания сетчатки, сосудистые, воспалительные. Исследования молекулярных механизмов  микроглиальных клеток и их взаимодействие с другими клетками сетчатки и имунной системы. Процессы абляции и репопуляции микроглии. Функция микроглии при эмбриональном развитии. Новые методики выращивания культур микроглии, химерные и трансгенные животные и так далее. 

Требования: Работы на английском языке, посвящённые микроглиальным клеткам сетчатки, достаточно подробные и качественно выполненные, чтобы иметь шансы пройти рецензирование журнале уровня IF 7+. Работы могут быть выполненны в клеточной культуре с использованием микроглиальных линий например BV-2 или клеточных культур микроглии мозга, но в контексте процессов происходящих в сетчатке и связанных с глазом. Публикации о микроглиальных клетках мозга в котексте болезни Альцгеймера, Рассеянного склероза расмотрены не будут, если они не включают в себя компонента сетчатки или зрения.

Домашняя странциа журнала: https://www.frontiersin.org/journals/immunology

Домашная страница спецвыпуска: https://www.frontiersin.org/research-topics/23866/exploiting-new-methods-to-study-microglia-in-healthy-and-diseased-retina (на английском языке).

Окончание срока приёма статей: 28 Августа 2021 Тезис (abstract), 18 Декабря 2021 Статья (Manuscript).

Тема: Special Issue "Animal Models for Diabetes"

Журнал: Processes

Impact factor: 2.947

Отбор статей для спецвыпусков научных журналов Frontiers in Immunology и Processes Наука, Научные журналы, Научные работы, Научные открытия, Биология, Молекулярная биология, Молекулярная генетика, Лаборатория, Длиннопост

Иллюстрация: Sci Rep . 2018 Feb 12;8(1):2847. doi: 10.1038/s41598-018-21198-z. The NLRP3 Inflammasome May Contribute to Pathologic Neovascularization in the Advanced Stages of Diabetic Retinopathy

Тематика выпуска: Моделирование диабета на животных.

Требования: Работы на английском языке, посвящённые диабету, принимаются статьи как собственно использующих или представляющих моделирование диабета на мышах, крысах, данио рерио (zebrafish) так и клеточные системы, экспланты и органоиды in vitro. Работы не ограничены патологией глаз и могут включать исследования в области диабетического поражения мозга, почек, периферийных нервов и любых других проявлений диабета. В сравнении с Frontiers менее требовательный журнал по уровню и сложности научной работы более доступный для научных групп с ограниченным бюджетом.

Домашняя страница журнала: https://www.mdpi.com/journal/processes

Домашная страница спецвыпуска: https://www.mdpi.com/journal/processes/special_issues/animal_models_diabetes (на английском языке).


Первая статья принятая к публикации в рамках спецвыпуска. Samuel Álvarez-Almazán et al. "A New Symmetrical Thiazolidinedione Derivative: In Silico Design, Synthesis, and In Vivo Evaluation on a Streptozotocin-Induced Rat Model of Diabetes" https://www.mdpi.com/2227-9717/9/8/1294

Окончание срока приёма статей: 31 Октября 2021

Оба журнала имеют достойный индекс цитирования каталогизируются всеми релевантными поисковыми системами, включая PubMed имеют быстрый и конструктивный процесс рецензирования (peer review). Я никак не влияю на процесс рецензирования и принимаю окончательное решение по большей части на основании докладов рецензентов.

Для модератора: пост не является рекламным. Я не получаю какой-либо материальной или не материальной компенсации за организацию обоих выпусков и преследую сугубо научные цели. Я так же не являюсь сотрудником Frontiers in Immunology (Frontiers Publishing Group) или  MDPI. Я отвечаю за научную значимость публикаций обоих спецвыпусков на добровольных началах. Задача выпусков собрать наиболее новые и значимые научные работы по обеим тематикам. Мне кажется, что работы Российских авторов в международной научной литературе представлены недостаточно поэтому хотел поделиться информацией среди учёных которые читают Pikabu.
Показать полностью 2
23

Как учиться в аспирантуре в Финляндии не вставая с дивана.

Спойлер - никак.

Хотел бы немного рассказать о своем опыте учебы в Финляндии, а конкретно в Lappeenranta University of Technology. Я постоянно живу и работаю в Санкт-Петербурге в инженерной сфере, но конечно бываю и в Финляндии. Как-то раз я решил вернуться к своему давнему желанию написать диссертацию, посвящённую инженерии в каком-либо ее проявлении.
Если честно, я даже не думал о том, чтобы учиться или тем более работать в Европе. Но товарищи из Петербуржского Политехнического посоветовали мне профессора, который недавно переехал работать в Lappeenranta University of Technology и которому очень нужны были аспиранты. Я написал ему, и он согласился меня взять в аспиранты. В качестве тематики мы выбрали Системы автоматизированного проектирования (CAD) и Эскизное проектирование (Conceptual Design). К слову сказать, не обязательно иметь личное знакомство, чтобы попасть в аспирантуру - со мной учился парень который просто написал в Университет, что хочет у них учиться. Также я сразу обговорил с Профессором возможность того, что я буду учиться удаленно, он подтвердил, что это возможно. Для этого есть специальная программа - Industrial student (аспиранты, которые работают и учатся - что-то типа соискателей у нас).

Шаг нулевой - Что же такое учеба в аспирантуре в Финляндии.
Для защиты диссертации необходимо написать минимум 3 статьи с рейтингом JUFO (местный табель о рангах среди журналов) не менее 1 (всего 4 ступени, от 0 до 3). Также необходимо набрать 45 так называемых крЕдита (ECTS). Для того чтобы их получить, надо либо пройти курс в LUT (очно или дистанционно), или пройти онлайн-курс (причем руководитель должен согласовать его), либо же прочитать книгу (опять же согласованную с руководителем) и написать эссе по ней. Курсы проходятся также не какие нравятся, а по так, чтобы 2/3 кредитов были по своей тематике. Например, курс Artificial intelligence на 6 кредитов мне подходил, а Economics на 5 не очень. Количество кредитов зависит от длительности курса, если не ошибаюсь 26 часов учебы = 1 кредит. Обучение ведется на английском, хотя его уровень при поступлении никто не проверяет.

Шаг первый - Поступление.
Для поступления надо выполнить несколько несложных формальных шагов - написать план работ (из расчета 3-4 года) с указанием крупными мазками, чем же вы будете заниматься и предоставить свои документы о высшем образовании на английском языке (с заверенным переводом). Поскольку я учился в СПбПУ (Политех) никаких проблем с подтверждением диплома не возникло. План включал в себя список из десятка книг по инженерии и клятвенным уверением написать 3 статьи. Прием в аспирантуру ведется круглогодично. Всё общение производиться по электронной почте. В итоге, в ноябре я выслал копии своих документов, а в декабре получил уведомление, что я зачислен на курс Doctor of Science in Technology (Industrial Engineering and Management).

Шаг второй - Первый год учебы.
Для начала, я решил набирать кредиты. Для этого, я решил приехать в LUT на 2 недели на зимнюю школу и пройти два интенсивных курса (по 3 ECTS каждый), а также прочитать и сделать эссе книги Pugh "Total Design".
Зимняя школа меня удивила - то как проходили занятия крайне отличалось от моей учебы в России. Упор был сделан на занятиях в командах и решений практических задач. После зимней школы я понял, что уровень моего английского явно недостаточен, а Pugh со своим Total Design меня добил. Пришлось садиться за книги и вспоминать английский. Также, я подписался на парочку курсов на курсере, чтобы поднабрать еще кредитов.
Весной Профессор неожиданно вспомнил о моем существовании и грозно предложил поехать на конференцию и что-то там рассказать (естественно о том, чем я занимаюсь). Пришлось срочно читать десятки статей, чтобы слепить хоть что-то напоминающее научную статью. Я решил писать о функциональных моделях и как я собираюсь их использовать в эскизном проектировании. Эта часть учебы была похожа на ад (только чуть похуже) - я приходил с работы (которая вообще никак не связана с моей учебой) и до позднего вечера читал статьи или набрасывал что-то для конференции. Здесь я и понял - чтобы учиться и работать нужна железная воля или человек с палкой который будет бить тебя по голове, как только ты отрываешься от учебы.
В итоге осенью мы поехали на конференцию в Германию, где я заикаясь, краснея и бледнея проблеял свои тезисы. Тут меня постигло еще одно удивление - для того, чтобы поехать не нужно было ничего. Получаешь ок от руководителя по электронной почте, выбираешь гостиницу и билеты, а LUT все оплачивает. Единственное, индустриальным студентам не полагается никаких командировочных.
К декабрю, зачтя 12 кредитов, я смог немного выдохнуть. В общем первый год прошел как в анекдоте - Ты едешь на велосипеде, но только ты горишь, велосипед горит и все вокруг горит.

К сожалению, уже вышла большая портянка, поэтому продолжу позже. Если что - готов ответить на вопросы.

Показать полностью
22

Как использовать Endnote в научных статьях?

@moderator,

Пост не является рекламным. Я никакого отношения к компании Thomson Reuters Corporation не имею, никого покупать Endnote не призываю. Покупать, искать бесплатные аналоги, качать триал, просить лицензию у своего профессора или качать с torrent, это сугубо личное дело каждого. Пост для научных сотрудников в моё сообщество "Как построить карьеру в Науке". До сих пор множество ученых оформляют цитаты вручную и теряют на этом массу времени, текст для них, исходя из собственного личного опыта.

-----


Работа с цитатами в тексте, особенно если она выполняется вручную, отнимает много времени и сил. Допустим, необходимо добавить цитату в начале текста, это означает, что нужно обновлять всю нумерацию цитат.


Наконец, после долгой монотонной и изнуряющей работы с текстом, статья готова для подачи в журнал, нумерация и формат выверены, но статья получает отказ в публикации, это значит нужно начинать все практически, сначала, и перерабатывать формат каждой цитаты. Учитывая, что разные журналы имеют разные требования к оформлению цитат как в тексте, так и в списке литературы, исправления манускрипта в процессе работы требуют всё новых цитат, а это значит нужно исправлять весь список заново, эта работа отнимает дни, а иногда и недели, авторы допускают ошибки в нумерации цитирования. К счастью, существует способ этот процесс автоматизировать и никогда больше не задумываться о нумерации и формате ваших цитат, перепоручив работу Endnote.


После установки программы возникает резонный вопрос, как же ей пользоваться?

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Открыв свою статью или новый документ в Word, вы увидите, что появилась новая панель инструментов, однако, что дальше? Для начала откройте Endnote, кликнув на красную кнопку EN.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Программа информацию о статьях получает из он-лайн каталогов, по умолчанию настроено соединение с Library of Congress, LISA, Pubmed и Web of Science. Можно добавить и другие, но, как правило, предустановленных достаточно. Разумеется, для загрузки новых цитат программе потребуется подключение к интернет. Теперь, подключившись к Pubmed, давайте найдём статью, которую вы бы хотели процитировать. Система поиска позволяет искать по массе параметров, но сам поиск реализован достаточно не гибко, на точных совпадениях, например, возникают сложности с греческими символами дефисами и так далее. Не будет точного совпадения, поисковый запрос придет пустым. Поэтому если поиск в Endnote не дает результатов это не значит, что статьи в каталогах нет, нужно изменить условия. Например, искать по имени автора, году публикации и названию журнала, нежели названии статьи, либо использовать первые несколько слов названия, вместо полного названия.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Итак, статья найдена, как перенести её в текст?

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Очень просто, кликните на найденном материале. Нажмите Ctrl+C или на Mac: Command + C теперь возвращайтесь в окно Word

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Выберите место, где цитата должна присутствовать. Теперь просто нажмите Ctrl/Command + V, в тексте появится ссылка вида {Authorname, 20XX #00000} если у вас уже определен стиль документа то спустя несколько секунд Endnote отформатирует её в формат указанного журнала, а в конце документа появится список литературы.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Чтобы изменить стиль нажмите на кнопку Format Bibliography на панели инструментов Endnote.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Выберите нужный стиль и нажмите Ok. На этом все, после нескольких секунд работы Endnote приведет ваше цитирование согласно стилю выбранного журнала для примера выберем стиль журнала Cell. Изменять стили можно сколько угодно раз и это займет не более нескольких секунд.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Разумеется, Endnote автоматически исправит нумерацию, если добавить новые ссылки в любую часть текста. Становится возможным вести цитирование по мере написания текста.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Наиболее эффективная для меня схема работы такая: Написать фрагмент текста, к которому нужна цитата, затем в Google найти подтверждающее это утверждение статью или книгу, (часто происходит и наоборот) затем скопировать название или автора в Endnote и добавить цитату в текст.


Если стиля журнала, в который вы хотите подать статью в списке стилей не оказалось, то забиваете в поиск %имя журнала% Endnote style и качаете ens файл.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё
Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Его вам нужно скопировать в C:\Program Files (x86)\EndNote X6\Styles (потребуются права администратора).

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

После чего, программу даже не нужно перезапускать, нужный стиль отыщется в разделе Format bibliography/Browse.

Как использовать Endnote в научных статьях? Длиннопост, Цитаты, Наука, Phd, Моё

Разумеется у программы есть масса других функций, но начать эффективно пользоваться автоматическим менеджментом цитат можно согласно этому руководству. А на сэкономленное таким образом время можно провести больше экспериментов или почитать pikabu.


Удачных открытий и публикаций!


P.S. Специфическая проблема для русских пользователей отсутствие научных работ на русском языке во многих он-лайн каталогах. Задумайтесь вот над чем, статьи на локальных языках обладают минимальным научным весом, они вряд ли посодействуют вашей научной работе.

Показать полностью 13
21

Как написать успешное письмо для стажировки или PhD

Если вы вобьёте в поисковик запрос «Учёный», то скорее всего получите в ответ кучу картинок людей с разноцветными колбами или загадочными надписями на доске. Иногда исследователи действительно задумчиво смотрят на цветные реактивы. Но значительную часть научной жизни занимает гораздо более скучное занятие – написание писем

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

И это ещё надо найти PhD-позицию...


Молодые и не очень исследователи пишут более опытным учёным чтобы найти место для практики или стажировки, договориться о совместной работе или продолжении обучения в докторантуре (PhD). Это может звучать легко, но на самом деле написание писем – тяжёлый труд. Часто чтобы найти позицию, письма приходится рассылать десятками. Почти половина из них останутся без ответа, а ещё на четверть будет получен отказ:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Чтобы понять, что влияет на успех письма, мы с биоинформатиком Дмитрием Бибой провели небольшое исследование. На момент написания этого текста нам удалось собрать 101 письмо от 10 человек. Мы изучили, как разные характеристики письма, отправителя и получателя влияют на вероятность ответа

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Пример письма (все персональные данные анонимизируются)


Так выглядят загруженные мной письма по датам. Видно попытки найти стажировку в 2019 году (большая часть которых была неуспешной), огромное количество отказов и игнорируемых писем в начале пандемии COVID-19 и поиск PhD в 2022 году

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Что влияет на успех письма?


Положительным ответом мы считали приглашение на интервью или позицию, а отрицательным – сообщение о том, что поработать вместе не получится. Вот как люди объясняют причины негативных ответов:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Если вам кажется, что это похоже на средний палец, знайте – каждый отказ чувствуется именно как этот жест


Самая частая причина отказа – «Нет возможности взять студента». Например, у профессора уже много студентов в лаборатории, в данный момент нет времени или проектов. На втором месте – форс-мажорные обстоятельства: например, переезд лаборатории в другое место или ограничения из-за COVID-19. Также вам могут отказать, потому что нет финансирования или нужно не писать письмо профессору, а подавать заявку на программу


Любопытно распределение ответов по времени отправления письма:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

По нашим данным ни на одно отправленное вечером письмо не был получен положительный ответ. Также распределение ответов неравномерно по дням недели:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Левый график позволяет посмотреть на количество писем в выборке, правый – сравнить доли ответов


На удивление часто приходит ответ на письма, отправленные в воскресенье. Также ни одно отправленное во вторник письмо не было проигнорировано. Но это может быть эффект небольшой выборки


Также по нашим данным успешнее были письма меньшей длины:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Если вы не привыкли читать боксплоты – «ящики с усами», может быть более понятен такой график:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Мы разделяли письма на «персонализированные» и «неперсонализированные». Первыми мы считали такие тексты, которые нельзя скопировать и отправить другому человеку с минимальными изменениями. То есть когда очевидно, что письмо написано для конкретного получателя, а не рассылается массово. Оказывается, что персонализация повышает вероятность ответа:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Около 70% персонализированных писем получили ответ (против примерно 45% неперсонализированных). Положительные ответы также приходят чаще – 40% против 20%. Надпись «p-value: 0.012» в левом верхнем углу означает, что если на самом деле распределение ответов не зависит от персонализации письма, мы получили бы такие или ещё более отличающиеся данные в 1.2% случаев


Для любителей статистики: здесь был использован точный тест Фишера, а в сравнении длин писем – критерий Краскела-Уоллиса

Некоторые письма в нашем датасете были написаны в формальном стиле (например, начинались со «Здравствуйте» или «Dear Dr. …»), а некоторые – в неформальном (скажем, начинались с «Hello»). Значимых отличий между успехом таких писем мы не обнаружили, хотя неформальные письма и игнорировались немного чаще:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Иногда люди описывают свои предыдущие проекты, научные интересы или навыки в письмах. К нашему удивлению, похоже, что это не влияет на распределение ответов:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост
Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост
Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Консультант по научной карьере Виктория Коржова рекомендует заканчивать письмо призывом к действию. Человек должен точно знать, чего от него ждут после письма. Например, окончание «Пожалуйста, скажите удобные даты для звонка» или «Можно ли пройти у вас стажировку с января по март?» считаются призывом к действию, а «Спасибо за ваше время» или «Надеюсь на ваш ответ» – нет. Мы классифицировали письма на две группы, но не обнаружили влияния призыва к действию на успех письма:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Иногда люди отправляют повторное письмо (follow-up) в случае, если первое осталось без ответа. И кажется, это отличная идея: такие письма игнорируются реже и получают больше положительных ответов

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Любопытно также было взглянуть на зависимость количества ответов от пола получателя и отправителя. В первом случае разницы нет: женщины и мужчины отвечают одинаково:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

А вот пол отправителя значительно влияет на результат! Положительных ответов девушки получают примерно столько же, сколько парни, а вот отрицательные им пишут реже:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

Возможно, девушкам менее охотно присылают отказы


Однако, к результатам нужно относиться с осторожностью: в исследовании пока приняло участие немного человек и это может приводить к смещению распределения из-за характеристик отдельных людей.


Выводы


Главная цель нашего исследования – показать, как можно писать более успешные письма. Вот несколько рекомендаций, которые мы можем дать на основе данных:


1. Будьте готовы писать много писем. Наши результаты могут быть даже слишком оптимистичны, так как несколько человек загрузило только успешные письма. Но даже согласно этим данным, скорее всего половину ваших писем проигнорируют, а ещё на четверть придёт отрицательный ответ


2. Ищите людей, у которых точно есть места. Отслеживайте учёных, которые недавно выиграли гранты или у которых есть открытые вакансии. Так шансы получить позицию гораздо выше


3. Пишите персонализированные письма. Потратьте время, чтобы было понятно, что вы действительно заинтересованы в позиции у конкретного человека. Так вероятность получить ответ выше


Пример абзаца из персонализированного письма. Отличная идея – упомянуть доклад учёного на конференции или его статью:

Как написать успешное письмо для стажировки или PhD Наука, Карьера, Phd, Ученые, Исследования, Статистика, Стажировка, Письмо, Инфографика, Человек наук, Длиннопост

4. Пишите повторные письма, если на первое не получен ответ. Это сильно повышает вероятность контакта


5. Если вы – девушка, будьте готовы получать ответы реже. Вероятность положительного ответа не зависит от пола, но отрицательные девушкам почему-то пишут реже. Не расстраивайтесь и продолжайте писать


6. Лучшие дни для отправки письма – вторник и воскресенье. Возможно, не стоит отправлять письма в понедельник и вторую половину недели. С воскресеньем всё же тоже лучше быть осторожным: письмо в выходной для кого-то может оказаться вторжением в личное пространство. Возможно, вторник – оптимальный день для отправки писем


7. Отправляйте письма в рабочее время (не забудьте про часовой пояс получателя). В крайнем случае лучше послать сообщение утром, но не вечером


8. Возможно, длинные письма менее успешны. Короткое письмо проще не только писать, но и читать. Возможно, отвечают на них тоже чаще


Относитесь ко всем советам с осторожностью. Данные, по которым сделаны выводы, не слишком большие, получены от людей из одной области – биологии, и могут быть нерепрезентативны. Если вы писали письма для стажировок, PhD или других программ, вы тоже можете принять участие в исследовании! Все данные анонимизируются, а при желании можем предоставить вам персональную аналитику ваших писем (абсолютно бесплатно)


Всем успешных писем и интересной работы!


Наш телеграм

Показать полностью 19
Отличная работа, все прочитано!